Ко 829а 01: Поливомоечная машина КО-829А-01 на шасси ЗИЛ-433362

>

автомобили, строительная спецтехника (Россия, Москва))

По вопросам покупки данной техники (КО-829А-01 универсальная комбинированная машина на шасси ЗИЛ 433362), условиях кредита и лизинга, сервисного и гарантийного обслуживания просьба обращаться к дилерам завода или в официальные представительства. Поставка КО-829А-01 универсальная комбинированная машина на шасси ЗИЛ 433362 может осуществляться как напрямую с завода-изготовителя, так и с площадок в Москве и других регионах РФ.

Универсальная комбинированная машина КО-829А-01 на шасси ЗИЛ-433362 предназначена для круглогодичного ухода за дорогами с твердым покрытием.

На комбинированной машине КО-829А-01 смонтировано специальное оборудование, состоящее из:

  • цистерны,
  • поливомоечного оборудования,
  • гидросистемы,
  • электрооборудования,
  • пневмооборудования,
  • водяного насоса с редуктором,
  • дополнительного оборудования,
  • кронштейна для установки запасного колеса.

Отбор мощности для привода рабочих органов производится от базового шасси посредством коробки отбора мощности (КОМ). Привод подъема и опускания плуга и щетки, привод вращения щетки — гидравлический, привод водяного насоса — механический.

Спецоборудование комбинированной машины КО-829А-01

  • поливомоечное,
  • плужное,
  • щеточное.

Технические характеристики КО-829А-01 на шасси ЗИЛ-433362

Колесная формула 4х2
Базовое шасси ЗИЛ 433362
Вместимость цистерны, м3 6,1
Ширина рабочей зоны при мойке, м 8,0
Ширина рабочей зоны при поливке, м 20
Ширина рабочей зоны при работе щеткой, м 2,5
Ширина рабочей зоны при снегоочистке, м
2,5
Давление создаваемое насосом, МПа 1,2
Габаритные размеры, мм длина 8900
ширина 2500
высота 2850

Технические характеристики базового шасси ЗИЛ 433362 можно посмотреть в описании, перейдя по этой ссылке.

Двигатель КО-829А-01 на шасси ЗИЛ-433362

Модель двигателя ЗиЛ-508.10
Тип двигателя бензиновый карбюраторный
Рабочий объем, л 6,0
Степень сжатия 7,1
Мощность, л.с. (кВт) 150 (110)при 3200 мин.-1
Крутящий момент, кгс·м (Н·м) 41 (402)при 1800-2000 мин.-1

Фотографии КО-829А-01 универсальная комбинированная машина на шасси ЗИЛ 433362

Поливомоечная машина КО-829А-01

Базовое шасси

ЗиЛ-433362

Мощность двигателя, л. с.

134

Тип топлива

бензин

Вместимость цистерны, м3

7

Ширина рабочей зоны, м

—  поливомоечного оборудования

20

—  щетки межбазовой

2,5

—  отвала переднего поворотного

2,5

Полная масса, кг

11200

Габаритные размеры, мм

—  длина

9400

—  ширина

3070

—  высота

3000

КОММАШ-АРЗАМАС КО-829А-01 — Дорожно-уборочные машины (KO-829A-01 — KOMMASH КО-829А-01 — KOMMASH-ARZAMAS KO-829A-01 — KOMMASH-ARZAMAS КО-829А-01 — Дорожно-уборочная машина КО-829А-01 — Дорожно-уборочная машина КОММАШ-АРЗАМАС КО-829А-01 — КО-829А-01 — КОМАШ-АРЗАМАС КО-829А-01 — КОММАШ КО-829А-01 — КОММАШ-АРЗАМАС КО-829А-01) — Технические характеристики КОММАШ-АРЗАМАС КО-829А-01 — Габаритные размеры КОММАШ-АРЗАМАС КО-829А-01 — Двигатель КОММАШ-АРЗАМАС КО-829А-01

1. Арнеда Поливомоечной машины
Дорожно-уборочная машина
2019 г.
17.07.2019
Спец-Авто-Альянс
г. Москва
цена по запросу
2. Аренда тракторов (подметально-уборочных машин) в
Дорожно-уборочная машина
2015 г.
16.11.2018
Аренда спецтехники «Генеральный партнёр»
г. Мурманск
цена по запросу
3. Аренда поливомоечных машин
Дорожно-уборочная машина
2016 г.
01.04.2018
Аренда поливомоечных машин
г. Москва
цена по запросу
4. Аренда комбинированной дорожной машины (КДМ) СПЕЦД
Дорожно-уборочная машина
2014 г.
04.12.2017

г. Екатеринбург
цена по запросу
5. Аренда комбинированной дорожной машины (КДМ) СААЗ
Дорожно-уборочная машина
2007 г.
04.12.2017
Импульс
г. Санкт-Петербург
9 000 РУБ/смена
6.
Аренда комбинированной дорожной машины (КДМ) Schmi

Дорожно-уборочная машина
2006 г.
04.12.2017
Делта
г. Санкт-Петербург
14 400 РУБ/смена
7. Аренда комбинированной дорожной машины (КДМ) Комма
Дорожно-уборочная машина
2009 г.
03.12.2017

г. Москва
цена по запросу
8. Аренда машины дорожной разметки Winter WTE 251 GTL
Дорожно-уборочная машина
2015 г.
03.12.2017
Дорлайн Инжиниринг
г. Москва
цена по запросу
9.
Аренда комбинированной дорожной машины (КДМ) Комма

Дорожно-уборочная машина
2015 г.
03.12.2017

г. Всеволожск
12 000 РУБ/смена
10. Аренда комбинированной дорожной машины (КДМ) HYDRO
Дорожно-уборочная машина
2013 г.
03.12.2017
СтройРент
г. Москва
цена по запросу

КО-829А1-01

Сайт в разработке. Пожалуйста, уточняйте информацию по тел. 8 (495) 925-66-11

  1. Главная
  2. Каталог
  3. Поливомоечные машины
  4. КО-829А1-01
Базовое шасси КамАЗ-43253- G5
Мощность двигателя, л. с. 185
Плужное оборудование, наличие +
Щеточное оборудование, наличие +
Вместимость цистерны (м3) 7
Ширина рабочей зоны, м (при мойке) 8,5
Ширина рабочей зоны, м (при поливке) 20,0
Ширина рабочей зоны плуга обычного (м) 2,5
Ширина рабочей зоны щетки (м) 2,5
Масса машины полная, кг. 15100
Длина, мм 9900
Ширина, мм 3070
Высота, мм 3200
Завод-производитель Арзамасский завод «Коммаш»

Описание

Машина КО-829А1 обслуживает городские дороги с твердым покрытием и  предназначена для круглогодичного использования. Комплектуется оборудованием: поливомоечным, плужным, щеточным. В состав оборудования входят: цистерна, центробежный насос с коробкой отбора мощности, плуг с системой навески, щётка с гидравлическим приводом, гидросистема и электрооборудование.

Преимущества: маневренность, быстросъемное оборудование, высококачественная гидравлика и высокопрочные металлорукава высокого давления, управление рабочими органами машины осуществляется из кабины водителя

Комбинированная дорожная машина КО-829А1

Комбинированная дорожная машина КО-829А1 предназначена для круглогодичного использования по содержанию городских дорог с твёрдым покрытием.

В состав оборудования входят: цистерна, кузов с транспортёром и разбрасывающим диском, центробежный насос с коробкой отбора мощности, плуг с системой навески, щётка с гидравлическим приводом, гидросистема и электрооборудование.

Технологические особенности:

  • улучшенная гидравлика и высокопрочные металлорукава высокого давления
  • быстросъемное оборудование
  • управление рабочими органами машины осуществляется из кабины водителя
  • улучшенный маслоохладитель (в качестве сливной магистрали применена труба Ø83х4)
  • улучшенная конструкция решетки (для обеспечения измельчения слипшегося песка на решетках кузова применены  полосы 50х6 мм по аналогии с машинами серии КО-829Б)
  • проверенный временем транспортер пескоразбрасывателя (якорная цепь)

ОПЦИИ:

  • отвал передний поворотный
  • отвал передний поворотный (гидравлический)
  • щетка межбазовая
  • пистолет распылительный

Технические характеристики

  • Модель
    Базовое шассиКАМАЗ-43253 2х4
  • Весовые параметры и нагрузки
    Масса загружаемого песка, кгне более 7000
    Масса перевозимой воды, кгне более 7000
    Полная масса а/м, кг15500
    нагрузка на заднюю тележку, кг9280
    нагрузка на переднюю ось, кг5820
  • Габаритные размеры, мм
    Длина, мм9900
    Ширина, мм3070
    Высота, мм3320
  • Дорожно-уборочное оборудование
    Вместимость, м3
    кузова распределителя ПГМ4,5/5
    цистерны ННМ7/7,5
    Плотность распределения ПГМ, г/м2
    пескосоль50-500
    Ширина рабочей зоны, м
    низконапорной мойки2,5-20
    распределителя ПГМ2-10

Вся представленная на сайте информация, касающаяся технических характеристик, наличия на складе, стоимости товаров, носит информационный характер и ни при каких условиях не является публичной офертой, определяемой положениями Статьи 437(2) Гражданского кодекса РФ.

Запчасти КО-829А, КО-829А-01, КО-829А1, КО-829А-10, КО-829АД, КО-829Б, КО-829Д, КО-829С1 Низкие цены. Оптом

Запасные части КО-829А, КО-829А-01, КО-829А1, КО-829А-10, КО-829АД, КО-829Б, КО-829Д, КО-829С1

Запчасти Арзамас

Запчасти Коммаш Арзамас

 

Наименование

Номер

КО-829А

 
 

ЗВЕЗДОЧКА

КО-104А.01.03.008

 

УСТ.ЦЕНТРОБЕЖ. НАСОСА

КО-829А.42.00.000

 

НАСАДОК

КО-829А.43.06.000

 

УСТАНОВКА ЩЕТКИ

КО-829А.47.00.000-01

 

УСТАНОВКА ПЛУГА

КО-829А.48.00.000

 

КОМ С МАСЛЯНЫМ НАСОСОМ

КО-829А.51.02.000-01

 

УСТАНОВКА НАСОСА

КО-829А.54.02.000

 

ВАЛ ВЕДОМЫЙ

КО-829А.56.03.012

 

Ролик

КО-829А.56.03.017

 

Разбрасыватель

КО-829А.73.04.000

 

Диск в сборе

КО-829А.73.04.300

 

Цистерна

КО-829А.89.01.000

 

Вал ведущий

КО-829Б.03.10.001

КО-829А-01

 
 

УСТ. ЦЕНТРОБЕЖ. НАСОСА

КО-829А.42.00.000

 

НАСАДОК

КО-829А.43.06.000

 

УСТАНОВКА ЩЕТКИ

КО-829А.47.00.000-01

 

Щетка

КО-829А.04.04.000-01

 

ОПОРА ПРИВОДНАЯ

КО-829А.47.05.000

 

ОПОРА

КО-829А.47.11.000

 

УСТАНОВКА ПЛУГА

КО-829А.48.00.000

 

КОМ С МАСЛЯНЫМ НАСОСОМ

КО-829А.51.02.000-01

 

КОРПУС

КО-829А.51.02.025-01

 

Цистерна

КО-829А.89.01.000

КО-829А1

 
 

ВАЛ ВТОРИЧНЫЙ

53213-4215070

 

МУФТА ВКЛЮЧЕНИЯ КОМ

53213-4215271

 

ВИЛКА

53213-4215280

 

ЗВЕЗДОЧКА

КО-104А.01.03.008

 

Щетка

КО-829А.04.04.000-01

 

НАСАДОК

КО-829А.43.06.000

 

ОПОРА ПРИВОДНАЯ

КО-829А.47.05.000

 

ОПОРА

КО-829А.47.11.000

 

ЛЕМЕХ

КО-829А. 48.01.001

 

ВАЛ ВЕДОМЫЙ

КО-829А.56.03.012

 

Ролик

КО-829А.56.03.017

 

Разбрасыватель

КО-829А.73.04.000

 

Цистерна

КО-829А.89.01.000

 

Вал ведущий

КО-829Б.03.10.001

 

НАСОС ЦЕНТРОБЕЖНЫЙ

КО-829Б.06.02.100

 

Отвал городской

КО-829Б1.11.00.000

 

Насос центробежный

КО-829Д.06.02.100

 

Плита монтажная

КО-829С2.05.00.000

КО-829А1-01

 
 

Щетка

КО-829А.04.04.000-01

 

НАСАДОК

КО-829А.43.06.000

 

ОПОРА ПРИВОДНАЯ

КО-829А.47.05.000

 

ОПОРА

КО-829А.47.11.000

 

ЛЕМЕХ

КО-829А.48.01.001

 

Цистерна

КО-829А.89.01.000

 

Насос центробежный

КО-829Д.06.02.100

КО-829АД

 
 

ЗВЕЗДОЧКА

КО-104А.01.03. 008

 

УСТ.ЦЕНТРОБЕЖ. НАСОСА

КО-829А.42.00.000

 

НАСАДОК

КО-829А.43.06.000

 

УСТАНОВКА ЩЕТКИ

КО-829А.47.00.000-01

 

УСТАНОВКА ПЛУГА

КО-829А.48.00.000

 

КОМ С МАСЛЯНЫМ НАСОСОМ

КО-829А.51.02.000-01

 

УСТАНОВКА НАСОСА

КО-829А.54.02.000

 

ВАЛ ВЕДОМЫЙ

КО-829А.56.03.012

 

Ролик

КО-829А.56.03.017

 

Разбрасыватель

КО-829А.73.04.000

 

Цистерна

КО-829А.89.01.000

 

Вал ведущий

КО-829Б.03.10.001

КО-829Б

 
 

ВАЛ ВТОРИЧНЫЙ

53213-4215070

 

МУФТА ВКЛЮЧЕНИЯ КОМ

53213-4215271

 

ВИЛКА

53213-4215280

 

ПРОКЛАДКА

АНМ53-09.00.001

 

ГАЙКА НАКИДНАЯ

АНМ53-09.00.002

 

ВТУЛКА

АНМ53-09.00.004

 

ЗВЕЗДОЧКА

КО-104А. 01.03.008

 

Щетка

КО-829А.04.04.000

 

НАСАДОК

КО-829А.43.06.000

 

ОПОРА ПРИВОДНАЯ

КО-829А.47.05.000

 

Ролик

КО-829А.56.03.017

 

Разбрасыватель

КО-829А.73.04.000

 

Вал ведущий

КО-829Б.03.10.001

 

Цепь со скребками

КО-829Б.03.10.100

 

НАСОС ЦЕНТРОБЕЖНЫЙ

КО-829Б.06.02.100

 

Установка блока клапанов АА31-ОС2

КО-829Б.81.01.000

 

Плита монтажная

КО-829С2.05.00.000

КО-829Д

 
 

ЗВЕЗДОЧКА

КО-104А.01.03.008

 

Щетка

КО-829А.04.04.000

 

НАСАДОК

КО-829А.43.06.000

 

ПОЛУМУФТА

КО-829А.47.05.001

 

ЛЕМЕХ

КО-829А.48.01.001

 

ВАЛ ДИСКА

КО-829А.56.02.220

 

Ролик

КО-829А.56.03.017

 

Диск в сборе

КО-829А. 73.04.300

 

Вал ведущий

КО-829Б.03.10.001

 

Сребок

КО-829Б.03.10.101

 

НАСОС ЦЕНТРОБЕЖНЫЙ

КО-829Б.06.02.100

 

Насос центробежный

КО-829Д.06.02.100

 

Установка плиты монтажной

КО-829Д.16.00.000

 

Цистерна

КО-829Д.74.01.000

КО-829Д-01

 

КО-829С1

 

 

ООО «СпецАвтоСнаб» — один из крупных поставщиков техники, дорожного оборудования и запасных частей в такие организации как:

— ОАО «Камчатавтодор»  Петропавловск-Камчатск

— Мордовавтодор г. Саранск

— Тюменское областное дорожно эксплуатационное предприятие (ОАО ТОДЭП)

— ГП Северавтодор г Сургут

— Филиалы ОАО «Ханты-Мансийскдорстрой»

— Филиалы Примавтодор — дальний восток

— Омскавтодор, Корпорация Енисей Омск

— Филиалы «Свердловскавтодор»

— Севзапдорстрой г. Архангельск

— Предприятия «Управления автодорог по Курганской области»

— Авиакомпания «Ямал»

— Аэропорт Магадан

И сотни других дорожных и коммунальных предприятий России и стран СНГ.


С нами НАДЁЖНО!

ЦЕНУ ПОЖАЛУЙСТА УТОЧНЯЙТЕ ПО ТЕЛ 8-800-234-45-74 ЗВОНОК БЕСПЛАТНЫЙ

Краткие характеристики спецтехники. Статьи компании «ООО «Дормаш-К»»

Таблица 1.1

Характеристики поливомоечных машин

 

Марка

 

Тип

 

Базовое шасси

 

Вмести­мость цистерны,

м3

 

Ширина мойки, м

 

Ширина полива, м

 

ПО-451

 

Прицеп

 

МТЗ-80/82

 

4,50

 

5,0

 

13,0

 

КО-820

 

Универсальная

 

ГАЗ-3302

 

0,95

 

 

3,0

 

КО-829

 

»

 

ЗИЛ-530 1БО

 

2,80

 

 

3,0

 

КО-804

 

»

 

ЗИЛ-433362

 

6,00

 

8,0

 

18,0

 

КДМ-130В

 

»

 

ЗИЛ-433362

 

6,00

 

8,0

 

18,0

 

ЭД-226

 

»

 

ЗИЛ-433102

 

6,00

 

8,0

 

18,0

 

КО-730

 

»

 

ЗИЛ-433362

 

6,35

 

8,5

 

20,0

 

ЭД-244

 

»

 

МАЗ-5337

 

7,50

 

8,0

 

18,0

 

КО-806

 

»

 

КамАЗ-4925

 

8,00

 

8,5

 

20,0

 

ЭД-403

 

»

 

ЗИЛ-133Г4

 

8,00

 

8,0

 

18,0

 

ЭД-410

 

»

 

ЗИЛ-133Д4

 

8,00

 

8,0

 

18,0

 

ЭД-405

 

»

 

КамАЗ-53213

 

9,50

 

8,0

 

18,0

 

МДК-133Г4

 

»

 

ЗИЛ-133Г4/Д4

 

10,0

 

8,0

 

18,0

 

ЭД-243

 

»

 

МАЗ-63039

 

10,0

 

8,0

 

18,0

 

 

Таблица 1. 2

Характеристики подметально-уборочных машин

 

 

 

 

 

 

 

Вмести-

 

Максималь-

 

Производи-

 

Марка

 

Базовое

 

Масса

 

мость

 

ная ширина

 

тельность

 

 

 

шасси

 

смета, кг

 

водяного

 

подметания,

 

техническая,

 

 

 

 

 

 

 

бака, м3

 

м

 

м2/ч

 

ПУМ-1

 

ГАЗ-3309

 

1875

 

1,0

 

2,8

 

46200

 

ПУ-93

 

ГАЗ-3309

 

1700

 

0,9

 

2,8

 

46200

 

МКПУ-1

 

ЗИЛ-433362

 

4700

 

0,75

 

2,8

 

42000

 

 

Таблица 1.3.

Характеристики плужных и плужно-щеточных снегоочистителей и распределителей песчаных смесей

 

Марка

 

Базовое шасси

 

Ширина захвата плуга, м

 

Ширина захвата щетки, м

 

Ширина посыпки, м

 

Вмести­мость бункера для песка,

м3

 

ТУ М- 1200

 

Специальное

 

1,55

 

1,40

 

1,20

 

0,16

 

ГАЗ-8017

 

»

 

1,55

 

1,40

 

 

 

4806АА (ПР-1)

 

ЗИЛ-433362

 

2,50

 

 

10,0

 

3,0

 

НО-075

 

МАЗ-5551

 

2,70

 

 

8,00

 

4,00

 

КО-804

 

ЗИЛ-433362

 

2,65

 

2,30

 

 

 

КДМ-130В

 

ЗИЛ-433362

 

3,00

 

2,34

 

10,0

 

3,25

 

ЭД-226

 

ЗИЛ-433102

 

3,00

 

2,34

 

10,0

 

3,25

 

КО-730

 

ЗИЛ-433362

 

2,50

 

2,30

 

9,00

 

3,00

 

МДК-4331

 

ЗИЛ-433102

 

2,50

 

2,30

 

9,00

 

3,25

 

ЭД-244

 

МАЗ-5337

 

3,00

 

2,34

 

12,0

 

5,60

 

КО-806

 

КамАЗ-4925

 

2,50

 

2,50

 

9,00

 

4,50

 

ЭД-403

 

ЗИЛ-133Г4

 

3,70

 

2,34

 

12,0

 

5,60

 

ЭД-410

 

ЗИЛ-133Д4

 

2,47

 

2,34

 

12,0

 

5,6

 

ЭД-405

 

КамАЗ-53213

 

3,00

 

2,34

 

12,0

 

6,50

 

МДК-133Г4

 

ЗИЛ-133Г4/Д4

 

2,50

 

2,30

 

9,00

 

5,6

 

ЭД-243

 

МАЗ-63039

 

5,25

 

2,30

 

12,0

 

6,00

 

АКПМ-ЗУ

 

Урал-4320

 

3,00

 

2,70

 

 

 

ЗМ-14

 

Урал-5557

 

2,80

 

 

 

 

КО-820

 

ГАЗ-3302

 

 

 

2,00

 

1,00

 

КО-829

 

ЗИЛ-5301БО

 

 

 

2,80

 

1,50

 

 

Таблица 1. 4

Характеристики снегопогрузчиков

 

 

 

Марка

 

 

 

Рабочий орган

 

 

Базовое шасси

 

Ширина полосы

очистки,м

 

 

Высота

погрузки/

дальность

отбрасы-

 

 

 

Максимальная

рабочая

скорость,

км/ч

 

 

 

 

 

 

 

вания, м

 

ТМ-ЗА

 

Лаповый

 

Спецшасси

 

2,4

 

3,5/-

 

3,5

 

КО-206А

 

»

 

»

 

2,6

 

3,8/-

 

2,5

 

КО-207

 

Фреза, ротор

 

МТЗ-82

 

2,0

 

3,6/-

 

 

СНФ-200

 

То же

 

МТЗ-82

 

2,0

 

2,5/25

 

0,75

 

КО-721

 

»

 

МТЗ-82

 

1,8

 

3,0/20

 

1,26

 

КО-817

 

»

 

КЗКТ-538ДС

 

3,4

 

-/30

 

9,0

 

ДЭ-210БЗ

 

Шнек, ротор

 

ЗИЛ-433422

 

2,56

 

-/25

 

7,8

 

ДЭ-210Б

 

То же

 

ЗИЛ131Н

 

2,56

 

-/33

 

7,8

 

ДЭ-226

 

»

 

Урал-4320-10

 

2,81

 

-/30

 

6,74

 

ДЭ-210У

 

»

 

Урал-4320

 

2,7

 

-/35

 

30

 

 

 

Машины для содержания дорог

Машина комбинированная уборочная МД-133-02 

Техническая характеристика МД-133-02

 

Базовое шасси

ЗиЛ-133Г42

Мощность двигателя, л. с. (кВт)

185 (136)

Полная масса машины в комплектации:

— плужное, щеточное, пескоразбрасывающее оборудование, кг

18400

— щеточное, поливомоечное оборудование, кг

18000

Транпортная скорость, км/ч

35

Рабочая скорость, км/ч:

— при патрульной снегоочистке дорожного полотна

до 30

— при скоростной очистке дорожного полотна от снега

50-60

— при распределении противогололедных материалов

до 20

— при мойке дорожного полотна

до 20

— при уборке мусора с дорожного полотна щеткой

10-20

Габаритные размеры, мм (длина х ширина х высота)

11600 х 3200 х 3000

Привод исполнительных механизмов

гидравлический

Управление

из кабины автомобиля рычагами

Отбор мощности

от двигателя автомобиля — КПП-КОМ

 

Машина комбинированная уборочная МД-133-02Предназначена для круглогодичного содержания федеральных и местных автомобильных дорог с твердым покрытием.Обеспечивает комплекс работ по патрульной снегоочистке свежевыпавшего снега, скоростной очистке снега с дорожного полотна, обработке дорожных покрытий противогололедными материалами, поливке и мойке дорожных покрытий и элементов дорожного обустройства, уборке мусора с проезжей части.


Машины комплексные (МК)

 

 

модель (гр/подъемность, колесная формула)

 

модель (гр/подъемность, колесная формула)

КамАЗ

53215 (12т. , 6х4)

УРАЛ

самосвал 55571 (10т., 6х6)

 

53229 (__т., 6х4)

 

 

 

53228 (16т., 6х6)

 

 

 

самосвал 55111 (11т., 6х4)

 

 

 

самосвал 65111 (14т., 6х6)

 

 

 

 

 

Монтаж навесного оборудования возможен на шасси изготовителя либо на шасси Заказчика. Предприятие осуществляет дооборудование и ремонт машин для содержания дорог, как собственного производства, так и прочих производителей.

 

Группы навесного оборудования, входящие в состав Машин комплексных

 

Навесное оборудование Машины Комплексной (нМК)

Номер группы

зимнее содержание дорог

Скоростной отвал

03

Передний поворотный отвал

04

Средний отвал

05

Боковой отвал

06

Пескоразбрасывающее оборудование

07

Пескоразбрасывающее оборудование в кузов самосвала

08

Летнее содержание дорог

Передняя щетка

09

Средняя щетка

10

Щетка для мойки дорожных ограждений

11

Водяная гребенка

12

Бак водяной

13

Бак водяной в кузов самосвала

14

Водяная система

15

Устройство для мойки дорожных знаков

16

 

 

Технические характеристики навесного оборудования

 

Скоростной отвал. Применяется для скоростной очистки дорог от свежевыпавшего снега.

 

 

Ширина рабочей зоны (м)

2,6

Рабочая скорость (км/ч)

40-60

Высота убираемого слоя свежевыпавшего снега (мм)

200

Габаритные размеры (мм)

 

Вес (кг)

 

 


 

Передний поворотный отвал. Применяется для уборки снега в городских условиях. Возможна работа, как на левую, так и на правую сторону.  

 

 

Ширина рабочей зоны (м)

2,6

Рабочая скорость (км/ч)

20-40

Высота убираемого слоя свежевыпавшего снега (мм)

200

Габаритные размеры (мм)

 

Вес (кг)

 

 

 

 

 

Пескоразбрасывающее оборудование. Применяется для посыпки дорог противогололедными материалами. Для удобства оператора на транспортере установлен реверс.

 

 

Ширина зоны посыпки (м)

2-10

Рабочая скорость (км/ч)

20-40

Объем кузова (м.куб.)

6,5

Тип цепи транспортера

якорная

Наличие реверса транспортера

есть

Габаритные размеры (мм)

 

Вес (кг)

 

 

  

Передняя щетка. Осуществляет сметание мусора и пыли с проезжей части, для увлажнения смета на щетке установлена водяная гребенка.
Средняя щетка применяется в составе как летнего, так и зимнего оборудования.

 

 

Ширина рабочей зоны передней и средней щёток (м)

2,4

Рабочая скорость (км/ч)

20-40

 

 

 Щетка для мойки дорожных ограждений

 

 

Вылет щетки от оси автомобиля (м)

2,25

Рабочая скорость (км/ч)

10-15

 

 

Машина поливомоечная КО-829А-01

Предназначена для содержания городских дорог с твёрдым покрытием. В летний период машина используется для мойки и поливки дорожных покрытий, мойки прилотковой полосы и поливки зеленых насаждений. В зимний период машина используется для очистки дорожного полотна от свежевыпавшего снега. Выгрузка цистерны производится принудительно или самотеком. В состав оборудования входят цистерна, центробежный насос с коробкой отбора мощности, плуг с системой навески, щетка с гидравлическим приводом, гидросистема, электрооборудование.

 

 

Базовое шасси

ЗИЛ-433362

Вместимость цистерны, куб.м

6 (-0,4)

Ширина рабочей зоны, м при мойке при поливке плуга щетки

 

8

20

2,65

2,3

Полная масса, кг

11000

Габаритные размеры, мм

8900х2900х2850

 

Машина пескоразбрасывающая КО-829А-02

Предназначена для зимнего содержания городских дорог. Машина используется для очистки дорожного полотна от свежевыпавшего снега, посыпки инертными материалами поверхности тротуаров и дорог. В состав оборудования входят кузов с транспортером и разбрасывающим диском, центробежный насос с коробкой отбора мощности, плуг с системой навески,

щетка с гидравлическим приводом, гидросистема, электрооборудование

 

 

Базовое шасси

ЗИЛ-433362

Вместимость кузова пескоразбрасывателя, куб.м

3,1

Ширина рабочей зоны, м при посыпке плуга щетки

 

4 … 9

2,65

2,3

Полная масса, кг

11000

Габаритные размеры, мм

8900х2900х2850

 

 

 

МК-2000
 

 

 

Вакуумная подметально-уборочная машина предназначена для механизированной летней уборки дворов, тротуаров и других узких мест от мусора, пыли и грязи. Машина производит подметание загрязнения, пневматическое транспортирования смета в бункер-мусоросборник и его механизированную разгрузку самосвальным способом в ковш или большегрузный контейнер. Машина предназначена для эксплуатации в условиях умеренного климата.

Техническое описание:

Вакуумная подметально-уборочная машина представляет собой шасси Газель, на раме которого установлен комплект спецоборудования: подметальная система, вакуумная система, бункер-мусоросборник, водяная система, гидросистема, дополнительный подборщик.

Подметальная система смонтирована в базе машины и состоит из двух дискообразных (лотковых) щеток. Служит для формирования вала смета. Регулировка положения щеток и их привода осуществляется из кабины водителя и обеспечивает возможность перекрытия рабочей зоны. Привод вращения щеток — гидравлический; подъем, опускание и регулировка — пневмоцилиндрами.

Вакуумная система состоит из смонтированного позади задней оси машины всасывающего сопла, вытяжного вентилятора, установленного на бункере — мусоросборнике и пневмопровода. Служит для удаления с дорожной поверхности смета, подачи его по пневмопроводу в бункер — мусоросборник. Поднятие сопла осуществляется из кабины водителя. Привод вентилятора гидравлический.

Бункер — мусоросборник служит для хранения смета при работе машины, его транспортировании к месту выгрузки. Смонтирован на раме шасси. Разгрузка осуществляется самосвальным способом в большегрузный контейнер или ковш минипогрузчика. Подъем и опускание бункера и разгрузочной крышки осуществляется гидравлическим способом из кабины водителя.

Водяная система состоит из водяного бака, системы форсунок, коммуникации и водяного насоса. Служит для подачи воды в зону работы подметальной системы. Регулировка подачи воды осуществляется из кабины водителя.

Гидросистема служит для привода рабочих органов спецнадстройки. Управление рабочими органами осуществляется гидрораспределителями из кабины водителя. Скорость вращения щеток регулируется регуляторами расхода.

Дополнительный подборщик состоит из гибкой трубы, расположенной в задней части бункера — мусоросборщика. Служит для очистки труднодоступных мест. Сопло дополнительного подборщика перемещается вручную.

 

Технические характеристики

Наименование параметра, единица измерений

Значение

Модель шасси

ГАЗ 33027-111

Тип двигателя автономного спецоборудования

HATZ 3M41Z

Мощность двигателя автономного привода, кВт

39,2 при 2100 об/мин

Масса машины полная, кг

3500

Ширина уборки, м

2,5

Техническая производительность, м кв/ч, мах

15000

Эффективность уборки, % не менее

95

Масса загружаемого смета, кг. , не более

1000

Объем бункера, м. куб.

2

Емкость бака для воды, м. куб., не более

0,35

Габаритные размеры, мм, не более

5300х2000х2350

Высота разгрузки, мм, не менее

1500

Средний ресурс до первого капитального ремонта, ч, не менее

6800

Рабочая скорость, км/ч

4-6

Транспортная скорость, км/ч, не более

60

 

Гудронатор АЦБ-12

 

 

 

Технические характеристики АЦБ-12

 

Рекомендуемый тягач

КамАЗ-54115

Полуприцеп одноосный, двускатный, несущей конструкции

 

Полная масса полуприцепа-автогудронатора, кг

17270

Снаряженная масса,кг

5750

Рабочая скорость (пр розливе)

4,0….20,5

Битумный насос

Шестеренчатый, подача (номинальная) 1,4 л/об максимальной высотой подачи 30 м

Цистерна стальная эллиптического сечения с внутренними перегородками, термоизолированная слоем 50 мм и облицована стальным листом толщиной 0,8 мм

 

Вместимость цистерны, куб. м

12

Скорость снижения температуры транспортируемого материала,°С/ч,не более

4

Поддержание температуры материала обеспечивается горелками на дизельном топливе, работающими в автоматическом режиме

 

Число горелок, шт

2

Расход топлива одной горелкой, кг/ч

9

Наполнение цистерны через люк или собсьвенным насосом

 

Тип насоса

шестеренный

Подача, л/об

1,4

Развиваемое давление, кгс/кв. см

5

 

Гудронатор АЦБ-12

Предназначен для транспортировки жидких битумных материалов в горячем состоянии с мест производства с температурой до +200°С и равномерного распределения их при строительстве и ремонте автомобильных дорог. Автогудронатор состоит из седельного тягача и полуприцепа со специализированным оборудованием.

 

Битумощебнераспределитель ДС-180

 

Битумощебнераспределитель предназначен для розлива битума, равномерного однослойного распределения щебня мелких фракций по поверхности дорожного покрытия и его прикатки при строительстве и ремонте покрытий автомобильных дорог.

Поверхностная обработка дорожных покрытий повышает шероховатость, восстанавливает слой износа, защищает дорогу от неблагоприятного воздействия атмосферных явлений. Она позволяет надежно, эффективно и относительно недорого сохранять существующие сети дорог.

Известно несколько способов поверхностной обработки с применением битумов или битумных эмульсий.Один из них — одиночная обработка. На очищенное сухое покрытие дороги разливают органическое вяжущее вещество с распределением по нему щебня фракции 5-20 мм с последующим уплотнением.

Классический вариант технологической схемы устройства поверхностной обработки включает три самостоятельные единицы техники: автогудронатор, щебенераспределитель, прикатывающий каток. Этот вариант имеет ряд недостатков, влияющих на качество поверхностной обработки, ее однородность, и, что немаловажно, высокую себестоимость.

ОАО «Кургандормаш» совместно с ЗАО «Стройдормаш» и ОАО «ВНИИстройдормаш» разработало и изготовило агрегат поверхностной обработки, который позволяет выполнить всю технологическую схему одной единицей техники — битумощебнераспределителем ДС-180.

В настоящее время ДС-180 является уникальной спецмашиной, не имеющей аналогов в России и Ближнем Зарубежье и ее применение позволяет значительно снизить затраты любой организации на формирование парка машин для строительства и ремонта дорожного покрытия. На данный момент цена битумощебнераспределителя в 1,5 — 2 раза ниже стоимости стандартного набора технтки (из трех единиц) для поверхностной обработки.


Техническое описание ДС-180:

Битумощебнераспределитель ДС-180 представляет собой автопоезд в составе автомобильного тягача КамАЗ-54115 и полуприцепа, на раме которого установлен комплект оборудования: » битумная цистерна; » битумопровод с распределительной гребенкой и битумным насосом; » бункер-накопитель щебня; » щебнераспределитель; » уплотнитель щебня; » механизм загрузки; » рабочая площадка оператора.

Битумощебнераспределитель ДС-180 совмещает распределение вяжущего битума (или эмульсии) и щебня, тем самым обеспечивая минимальный разрыв во времени между нанесением слоя вяжущего вещества и слоя щебня, что обеспечивает их быстрое взаимодействие и последующее качественное сцепление. Упаковка (прикатка) кубовидного щебня и его закрепление обеспечивается металлическими вальцами с нагрузкой 2-2,5 тонны.

Рабочая скорость битумощебнераспределителя от 4 до 13 км/ч.

Битумная цистерна сварной конструкции, овальной формы, вместимостью 4000 л. Способ наполнения — наливом через горловину с фильтром или собственным насосом через приемный патрубок с фильтром. Цистерна оборудована поплавковым указателем уровня со звуковой сигнализацией верхнего уровня наполнения; дыхательной трубой, выравнивающей давление внутри цистерны с атмосферным давлением; термометром для контроля температуры битумного материала с пределом измерения от 0°С до 250°С.

Цистерна термоизолирована супертонким стекловолокном толщиной 50 мм и облицована стальным листом. Снижение температуры битума в цистерне в течение 1 ч (при стоянке) не более 3% перепада температур окружающего воздуха и битума, при движении со скоростью 50 км/ч не более 4% от перепада температур.

Система подогрева поддерживает температуру битума в цистерне в пределах от 80°С до 200°С. Подогрев битума в цистерне осуществляется через жаровую трубу одной стационарной горелкой на дизельном топливе, расход топлива 10 л/ч, подача топлива к горелке — сжатым воздухом от пневмосистемы автомобиля.

Топливный бак (20 л.) оборудован предохранительным клапаном, обеспечивающим давление сжатого воздуха 0,45 — 0,5 МПа, фильтром топлива. Скорость разогрева битума в цистерне 15 град/ч. Битумопровод с распределительной гребенкой и битумным насосом предназначен для создания давления и распределения потоков битума при выполнении рабочих операций.

Рабочее давление создается шестеренчатым битумным насосом с номинальной подачей 1,4 куб. дм./об., изменение направления потоков битума осуществляется кранами. Между собой элементы битумной коммуникации соединяются трубопроводами. Равномерный розлив битума на обрабатываемый участок обеспечивается распределительной гребенкой циркуляционного типа; ширина распределения 2,5 м. В нижней части распределительной гребенки на расстоянии 190 мм друг от друга установлены 14 форсунок с запорными соплами, обеспечивающими удельный расход битума от 0,7 до 1,3 л/кв.м.

Разогрев распределительной гребенки — циркуляцией горячего битума от битумного насоса. Для очистки коммуникации от остатков битума предусмотрена система промывки. В качестве промывочной жидкости используется дизельное топливо. Емкость бака 45 л.

Накопитель щебня

Накопитель щебня предназначен для принятия и накопления щебня

Состоит из двух частей: бункера-накопителя и нижнего бункера. Бункер-накопитель — отдельная сварная металлоконструкция, установленная на нижний бункер, выполненный за одно целое с рамой полуприцепа. Вместимость накопителя щебня 7 куб. м. (10000 кг)

На нижнем бункере расположен шибер-дозатор, предназначенный для уменьшения давления щебня на ротор щебнераспределителя. Щебнераспределитель роторного типа предназначен для равномерного однослойного распределения щебня по поверхности дорожного покрытия. Ширина распределения щебня (фракции 5-10 или 10-15 мм) составляет 2,5 м. На валу ротора есть тахометр, по показаниям которого устанавливается число оборотов ротора, а следовательно и производительность щебнераспределителя, в зависимости от удельного расхода щебня и рабочей скорости передвижения оборудования.

Удельный расход щебня 7 — 30 кг/ кв.м. Уплотнитель щебня предназначен для прикатки распределенного щебня по полотну дороги. Ширина прикатки 2,5 м. Рабочий орган — установка из трех вальцев на общей траверсе. Каждый валец оборудован скребками для очистки от налипшего щебня. Для уменьшения налипания битума и щебня на вальцы, уплотнитель оборудован системой смачивания вальцев водой, объем бака для смачивания вальцев 250 л.

Установка вальцев в рабочее положение и их нагружение выполняется механизмом нагружения, позволяющим изменять удельное давление вальцев на полотно дороги. Механизм загрузки предназначен для приемки щебня из самосвала и загрузки в бункер-накопитель. Способ загрузки — циклический, по мере выработки. Механизм загрузки представляет собой погрузчик с ленточным транспортером и приемным бункером с откидывающимися бортами для расширения приемной зоны при загрузке из автосамосвала.

Щебень из приемного бункера через дозировочные окна, оборудованные регулирующими заслонками, попадает на две транспортерные ленты шириной по 500 мм.

Источник энергии для работы всех механизмов битумощнбнераспределителя — двигатель тягача.

Привод всех агрегатов — гидравлический.

Установка механизмов в рабочее положение осуществляется гидроцилиндрами. Управление рабочими органами — дистанционное, электрогидравлическое с рабочего места оператора.
 

Преимущества:

Реализация технологии поверхностной обработки с помощью битумощебнераспределителя ДС 180 обеспечивает:

  • применение ДС-180 позволяет за один час работы нанести покрытие минимум на 2 км автодороги; ,
  • снижение расхода вяжущего вещества на 10-12%, т.е. на 500-600 кг/км покрытия;
  • снижение расхода щебня на 40-45%, на 25-30 куб.м/км покрытия;
  • снижение расхода топлива;
  • увеличение срока службы дорожной одежды на 20%, т.е 2-3 года;
  • увеличение срока службы дорожного покрытия после поверхностной обработки (ШПО) на 30%, т.е. до 4-5 лет;
  • повышение безопасности труда при проведении работ.

10+ ЗАПЧАСТИ ДЛЯ ЗИЛ ТОП поставщиков из 🇷🇺 России, Казахстана [2021]

Русские Запчасти на ЗИЛ

🇷🇺 TOP Exporter Запчасти на ЗИЛ из РФ

Запчасти для зил фирм-производителей Вы много купите эту продукцию:

Поставщик

Товар из России

  • Транспортные машины 43344Н (пожарные автоцистерны АЦ 3.0-40 (531342), АС 3.0-40 (4334), АС 3.5-40 (531342), АС 3.5-40 (4334)) на шасси АМУР-531342, ЗИЛ-433442, ЗИЛ-433475, ЗИЛ-4334В2, ЗИЛ-4334В5.
  • Транспортные средства: 43441Н на шасси ЗИЛ-433362, 43441С на шасси ЗИЛ-433112, 43441Э на шасси ЗИЛ-432932 в модификациях 0, 1, 2, 3.
  • Транспортные средства: 434412 на шасси ЗИЛ-433362, 434413 на шасси ЗИЛ- 432932.
  • Мусоровозы КО-440А, КО-440-4, КО-440АД, КО-440-4Д на шасси ЗИЛ-433362, ЗИЛ-494560, ЗИЛ-432932, ЗИЛ-497442
  • Шламоотсосы КО-510, КО-510Д, вакуумные машины КО-520, КО-520Д, машины для очистки канализационных сетей КО-502Б-2, КО-502Д на шасси автомобилей ЗИЛ-433362, ЗИЛ-494560, ЗИЛ-432932, ЗИЛ-497442
  • Комбинированные машины КО-829А, КО-829АД на шасси автомобилей ЗИЛ-433362, ЗИЛ-494560, ЗИЛ-432932, ЗИЛ-497442
  • Грузовые автомобили 279520, 279521, 279522, 279523, 279524, 27758Г, 27759Г, 27760Г на шасси ЗИЛ-433362, ЗИЛ-433112, ЗИЛ-432932

    автоцистерны для перевозки сжиженных углеводородных газов 5661-0000010-01, 46542-0000010 на шасси ЗИЛ-433362, ЗИЛ-432932

    Пылесборное оборудование: Промышленные пылесосы: ЗИЛ 900М, ЗИЛ 1200М

    .

    Провода и жгуты к автомобилям для автомобилей производства ОАО «АВТОВАЗ», ОАО «ГАЗ», ООО «ЛиАЗ», ОАО «КамАЗ», ОАО «ЗИЛ», ООО КЗ «РОСТСЕЛЬМАШ»

    Газоочистное оборудование: вентиляционные пылеуловители ЗИЛ 900; ПА 2-12

  • Сменные системы выпуска выхлопных газов из двигателей, включая глушители и резонаторы для автомобилей «Москвич», «ИЖ», «УАЗ», «ЗИЛ», «ГАЗ», «ПАЗ», «ВАЗ», «ВИС», «AUDI». »,« BMW »,« Chevrolet »,« Chery »,« Daewoo »,« Ford
  • Глушители (см. Приложения, формы №0238273, 0238274, 0238275, 0238276) используется для обслуживания и ремонта автомобилей Москвич, ИЖ, УАЗ, ЗИЛ, ГАЗ, ПАЗ, ВАЗ, ВИС, AUDI, BMW, Chev
  • Глушители и резонаторы (см. Приложение, формы № 0238558, 0238559), применяемые для технического обслуживания и ремонта автомобилей ВАЗ, УАЗ, ГАЗ, ПАЗ, ЗИЛ. Технические условия ТУ 37.402.001-96, ТУ
  • Глушители и резонаторы для обслуживания и ремонта автомобилей марок ВАЗ, УАЗ, ГАЗ, ПАЗ, ЗИЛ
  • .

  • Комплектующие, поставляемые в качестве сменных (запчастей) для сервисного обслуживания автомобилей КАМАЗ, МАЗ, ЗИЛ, УАЗ, ГАЗ, ПАЗ — Диски сцепления (артикулов — 14.1601130К, 25.1601130,
  • Комплектующие, поставляемые в качестве сменных (запчастей) для гарантийного обслуживания автомобилей ГАЗ, ЗИЛ, КАМАЗ, МАЗ, ПАЗ, HYUNDAI, ISUZU, HINO, MITSUBISHI, KIA — Датчики скорости динамические, мод.

    Пневматические тормозные приводы (согласно приложению формы № 0295455-0295459), применяемые для послепродажного обслуживания и ремонта автомобилей КАМАЗ и ЗИЛ, изготовленных в соответствии с ТР

    Запасные части и комплектующие торговой марки ГПЗ для обслуживания и ремонта автомобилей ГАЗ, ВАЗ, ЗАЗ, ПАЗ, КАМАЗ, ЗИЛ, ЛиАЗ, КрАЗ, МАЗ, Урал, УАЗ, САЗ, изготовленные в соответствии с требованиями ТУ

    .

    Трубки гидропривода тормозов автомобилей УАЗ, ИЖ, АЗЛК, ГАЗ, ВАЗ, ЗИЛ, УралАЗ и автобусов ПАЗ (см.0238381, 0238382, 0238383, 0238384, 0238385, 0238386). Т

  • Комплектующие, используемые для технического обслуживания и ремонта автобусов ПАЗ, КАВЗ, ЛИАЗ, автомобилей ЗИЛ, МАЗ, КАМАЗ (см. Приложение, форма 0295855), изготовленные в соответствии с техническим регламентом Таможни
  • Комплектующие, используемые для обслуживания и ремонта ПАЗ, Автобусы КАВЗ, ЛИАЗ, автомобили ЗИЛ, МАЗ, КАМАЗ (см. Приложение, форма 0295856), изготовленные в соответствии с техническим регламентом Таможни
  • .

  • Запасные части (см. Приложения, формы №0238481, 0238482), используемые для технического обслуживания и ремонта автомобилей ЗИЛ и автобусов ПАЗ, изготовленных в соответствии с требованиями Технического регламента Таможни
  • Запасные части (см. Приложения, формы № 0196337, 0196338, 0196339), используемые для технического обслуживания и ремонта автомобилей ЗИЛ и автобусов ПАЗ
  • Запасные части пневмопривода тормозов (см. Приложения, формы №0196329, 0196330, 0196331, 0196332, 0196333, 0196334, 0196335), используемые для обслуживания и ремонта автомобилей ЗИЛ и КамАЗ
  • Запасные детали пневмопривода тормозов (см. приложения, формы №0196211, 0196212, 0196213, 0196214, 0196215, 0196216, 0196217), используется для обслуживания и ремонта автомобилей ЗИЛ и КАМАЗ
  • Автомобили категории N2 типа: АБ-3324, АФ-4741, АЭ-3324, МАВР-48851, СКП-38510 и их модификации на базе шасси и автомобилей ЗИЛ-5301; АБ-4741, АФ-4741, МАВР-48850 и их модификации на базе шасси

    Автомобили мод. 7836 ?? категория М3 на шасси автобуса. ЗИЛ — 5301В2, — 5301Е2

    Автомобили мод. АМОР ?? категория N2 на шасси автора.ЗИЛ

    Трап пожарный АЛ-30 (131) М модель 06 ПС (на шасси ЗИЛ-131) в результате модернизации трапа АЛ-30 ПМ-506 или АЛ-30 Л-21

    Автомобили типа 45453А, 45463А, 59329-4 на шасси, ЗИЛ-497442 (Евро-4) категории N2, номер VIN X3D ??????????????

    Газоочистное и пылеулавливающее оборудование: пылеуловители типа ЗИЛ производительностью по очищаемому воздуху от 700 до 1600 м3 час, изготовленные по ТУ 3646-010-11575459-05

    .

    Блок дезинфекции ДА-10 на шасси автомобилей УАЗ, ГАЗ, ЗИЛ и их модификаций

    Рукавные фильтры следующих типов: ФРИР, ФРА, ФРКА, РКИЭ, РП, РВ, РС1 (СМЦ), ФР и вентиляционные пылеуловители ЗИЛ

    Запасные части для технического обслуживания и ремонта грузовых автомобилей КАМАЗ, МАЗ, Урал, ГАЗ, ЗИЛ: сменные выхлопные системы двигателей: глушители моделей АТ-1006-1210-010СБ, АТ-1007-12

    Запасные части для технического обслуживания и ремонта автобусов ПАЗ, КАВЗ, ЛиАЗ, автомобилей ЗИЛ, МАЗ: барабаны тормозные модели 23-3502070. А62, 23-3502070-10.А62, 3205-3501070.А62, 130-3502070.А62, 133-3501

    Элементы выхлопной системы автомобилей ВАЗ, ГАЗ, УАЗ, ЗИЛ, Москвич, ИЖ, Daewoo Nexia, Daewoo Matiz, Hyundai Accent, Chevrolet Lanos, Renault Logan, Hyundai Porter, автобусов Foton и ПАЗ (см.

  • Комплектующие к автомобилям: накладки барабанные тормозные для грузовых автомобилей ЗИЛ, КАМАЗ и прицепов из асбестового состава шифр 143-63,
  • .

    Главный и вспомогательный глушители с трубами в сборе (см. Приложения, формы №0196371, 0196372) автобусов ГАЗ, ИЖ, Москвич, ВАЗ, УАЗ, ЗИЛ и ПАЗ.

    Глушители (см. Приложения, формы № 0238094, 0238095) для обслуживания и ремонта автомобилей ГАЗ, ИЖ, Москвич, ВАЗ, УАЗ, ЗИЛ и автобусов ПАЗ.

    Автомобили (категории N2, N3) ЗИЛ с кабиной типа 433100, 5301А0, 442300, 433104, 5302АА, 530104

  • Автомобили ЗИЛ, тип 432930
  • Портативный диагностический рентгеновский аппарат 12Л7-УР на шасси автомобилей ЗИЛ-5301Е2, КамАЗ-4326, КамАЗ-53215, КамАЗ-43114, КамАЗ-4308, ISUZUNQR-75P, ISUZUNQR-75R, FOTON BDAJ1069, HYHD X-ray
  • Передвижной рентгеновский кабинет КРП-УР по ТУ 9442-003-63188370-2012 в следующих исполнениях: на шасси автомобилей ЗИЛ-5301Е2, КамАЗ-4326, КамАЗ-53215, КамАЗ-43114, КамАЗ-4308, ISUZU NQR-75P, ISUZU NQR-75R, ФОТО
  • 🇷🇺ТОП 34 проверенных поставщиков из России

    Товары-родственники

  • Запчасти ЗИЛ

    Получите Актуальную цену на Запчасти на ЗИЛ

    • Шаг 1: Связаться с продавцами и узнать о Запасные части на ЗИЛ
    • Шаг 2. Получите предложения от продавца.
    • Шаг 3. Скажите продавцу, чтобы он отправил вам контракт на обеспечение торговых операций.
    • Шаг 4: Подтвердите договор и произведите оплату.
    Мы можем проверить контрагенты:
    • Уровень транзакции
    • Оценки и отзывы покупателей
    • Последние транзакции
    • Торговая емкость
    • Производственная мощность
    • НИОКР
  • -829


    |

    -829 /, -829, -829:
    -.
    — -,.
    -,,.
    — :,,,,,.

    -829, -8291:
    -.
    -.
    — -8291:,,,,

    -829

    КО-829
    -829

    КО-829

    КО-829

    КО-8291

    -829

    -65115-1041-62 -43255
    -65115
    -53605
    , 110/96 206 134 206 206

    , 3 6 13,5 10 8,5
    , 3 3,1 7,0 3,1 7,0 4,5
    (), 20 20 (8,5) 3,5 20 (8,5)
    , 4. ..9 4 … 9 4 … 9 3 … 12 4 … 9
    , 2,5 2,5 2,7 2,5
    , 2,5 2,5 2,5 2,5
    ,

    11200/
    11000

    24000 14300 25200 17500
    ,:


    9400
    3070
    3000


    10740
    2900
    3100


    6900
    2500
    3500


    11000
    3100
    3400


    9850
    2900
    3200


    КО-829 КО-829
    КО-829 КО-829

    -829

    Линейное убиквитинирование участвует в патогенезе оптинейрина-ассоциированного бокового амиотрофического склероза

    Плазмиды

    Открытые рамки считывания OPTN человека, каспазы 8 и других комплементарных ДНК 6,8 были амплифицированы с помощью ПЦР с обратной транскрипцией. Мутанты этих кДНК были получены методом QuikChange, и были проверены полные нуклеотидные последовательности. КДНК лигировали с соответствующими последовательностями эпитопа и клонировали в векторы pcDNA3.1 (Invitrogen) и pMAL-c2x (New England Biolabs).

    Антитела

    Следующие антитела были использованы для иммуноблоттинга, и полноразмерные изображения для иммуноблоттинга представлены на дополнительном рисунке 15. Каталожный номер и разведения указаны в скобках. P-IκBα (9246; 1: 1000), IκBα (4812; 1: 1000), P-p105 (4806; 1: 1000), p105 (13586; 1: 1000), P-p65 (3033; 1: 1000) , p65 (8242; 1: 1000), P-IKKα / β (2697; 1: 1000), P-JNK (4668; 1: 1000), JNK (5668; 1: 1000), P-ERK (4370; 1 : 2,000), ERK (4695; 1: 2,000), каспаза 8 (4790; 1: 1,000), расщепленная каспаза 8 (Asp391) (9496; 1: 1000), каспаза 3 (9662; 1: 1000), расщепленная каспаза 3 (9661; 1: 1000), PARP (9542; 1: 1000), CYLD (8462; 1: 1000), TBK1 (3504; 1: 1000) и Lamin A / C (4777; 1: 2,000) были получены от Cell Сигнализация.OPTN (клон C-2, sc-166576; 1: 1000), убиквитин (клон P4D1, sc-8017; 1: 1000), TNFR1 (клон h371, sc-7895; 1: 1000), IKKα / β (клон H -470, sc-7607; 1: 1000), TRADD (sc-46653; 1: 1000) и NEMO (клон FL-419, sc-8330; 1: 1000) были приобретены в Santa Cruz Biotechnology. RIP1 (610458; 1: 1000) и FADD (610399; 1: 1000) были от BD Transduction Laboratories. OPTN (A301-829A, Bethyl and Proteintech; 1: 1000), линейный убиквитин (клон LUB9, MABS451, Millipore; 1: 1000), тубулин (CLT9002, Cedarlane; 1: 3000), NEMO (клон EA2-6, K0159- 3, MBL; 1: 1000), HOIP (SAB2102031, Sigma-Aldrich; 1: 1000), HOIL-1L (NBP1-88301, Novus Biologicals; 1: 1000) и SHARPIN (14626-1-AP, Proteintech; 1: 1000) также использовались.

    Клеточная культура и анализ люциферазы

    Клетки HEK293T и HeLa (ATCC) культивировали в среде DMEM, содержащей 10% фетальной бычьей сыворотки, 100 МЕ мл -1 пенициллина G и 100 мкг мл -1 стрептомицина и клеток BJAB ( ATCC) поддерживали в среде RPMI, содержащей 10% фетальной телячьей сыворотки и антибиотики, при 37 ° C и 5% CO 2 . Эксперименты по трансфекции проводили с использованием Lipofectamine 2000 или TurboFect (Thermo Fisher). Для экспериментов с KD контрольную миРНК (sc-37007) и миРНК OPTN (sc-39054), полученные от Santa Cruz Biotechnology, трансфицировали с помощью Lipofectamine RNAiMAX (Thermo Fisher).

    Плазмиду pGL4-IFNβ-промотор-Luc или pGL4-NF-κB-Luc котрансфицировали в клетки HEK293T или HeLa с плазмидой pGL4- Renilla -Luc / TK 50 . Через 24 часа после трансфекции клетки лизировали и активность люциферазы измеряли на люминометре GloMax 20/20 (Promega) с использованием системы анализа репортеров двойной люциферазы (Promega).

    Анализ MBP pull-down

    MBP-tagged полноразмерный OPTN и его мутанты (E478G, Q398X), полноразмерный NEMO и MBP-LacZ были экспрессированы в Escherichia coli Rosetta 2 (DE3) (Novagen) и очищены с использованием амилозной смолы (New England Biolabs).Для изучения способности связывания убиквитина слитые белки MBP (0,8 мкМ) и тетраубиквитин (2 мкМ) инкубировали в реакционном буфере (50 мМ трис-HCl pH 7,5, 150 мМ NaCl, 1 мМ дитиотреитол, 0,1% NP-40 и 250 мкг мл -1 BSA) при 37 ° C в течение 1 ч с последующим добавлением амилозной смолы 51 . Затем образцы инкубировали при 4 ° C в течение 1 ч при осторожном вращении, а затем шарики трижды промывали буфером без BSA и анализировали с помощью SDS-PAGE. Связанный убиквитин обнаруживали иммуноблоттингом с использованием антитела против убиквитина, а слитые белки MBP окрашивали кумасси бриллиантовым синим.

    Анализ SPR

    Кинетический анализ проводился на приборе Biacore X100 (GE Healthcare). Использовали сенсорный чип CM5 и рабочий буфер HBS-EP + (10 мМ Hepes-NaOH pH 7,4, 150 мМ NaCl, 0,05% Tween 20 и 3 мМ EDTA). Температуру проточных ячеек поддерживали на уровне 25 ° C. Линейный тетраубиквитин и БСА были иммобилизованы соответственно на измерительной ячейке и контрольной ячейке путем аминового связывания. Уровень иммобилизации линейного тетраубиквитина составлял около 500 RU. В каждом цикле в проточные кюветы вводили различную концентрацию белка OPTN, разбавленного буфером HBS-EP +, при 30 мкл мин -1 в течение 120 с.Время диссоциации 300 с. Наконец, сенсорный чип регенерировали путем введения 10 мМ NaOH в течение 30 с при 10 мкл мин. -1 . Анализ данных проводился с помощью программного обеспечения BIAevaluation.

    Кристаллография

    Ген, кодирующий OPTN CC2 и домен UBAN человека (остатки 416–510), был клонирован в вектор pGEX-6P (GE Healthcare). Меченный глутатионом S -трансферазой белок OPTN CC2-UBAN был сверхэкспрессирован в E. coli Rosetta 2 (DE3) и очищен смолой глутатион-сефарозы 4B с последующим расщеплением на колонке глутатиона S -трансферазы с использованием турбо-трансферазы (HRV3C) протеаза (Accelagen).Элюированный белок дополнительно очищали колоночной хроматографией Resource Q (GE Healthcare) с последующей колоночной хроматографией Superdex 75 (GE Healthcare). Линейный тетраубиквитин был экспрессирован в E. coli и очищен термической обработкой и ионообменной хроматографией с использованием колонки HiTrap SP (GE Healthcare) с последующей колоночной хроматографией Superdex 200 (GE Healthcare) 51 . Конечные концентрации исходных растворов OPTN и тетраубиквитина составляли 3,8 и 6,2 мг / мл -1 соответственно.Кристаллы получали в течение 1 недели при 20 ° C методом диффузии паров висячей капли путем смешивания 1 мкл раствора белка и 1 мкл резервуарного раствора (16% PEG 3350 и 250 мМ HCOOK). Кристаллы подвергали криозащите в резервуарном растворе с добавлением 25% этиленгликоля и мгновенно охлаждали в жидком азоте. Эксперименты по дифракции рентгеновских лучей были выполнены на канале BL41XU на SPring-8 (Хиого, Япония) при длине волны 1 Å и 100 К.

    Набор данных был обработан с помощью XDS 52 .Структуру определяли последовательным молекулярным замещением с использованием Phaser 53 и MOLREP 54 . Первый поиск молекулярных замен был выполнен с использованием Phaser 53 с линейным диубиквитином и полиаланиновой моделью димера NEMO CC2-UBAN, взятой из структуры комплекса NEMO-linear diubiquitin (PDB: 2ZVN) в качестве моделей поиска. Две копии диубиквитина и две копии димера CC2-UBAN были успешно размещены. Раствор фиксировали, а оставшиеся две линейные молекулы диубиквитина помещали с помощью MOLREP 54 .Построение и уточнение модели вручную выполнялись с использованием COOT 55 и PHENIX 56 соответственно. Типичная карта электронной плотности показана на дополнительном рисунке 4c. На графике Рамачандрана 95,5, 4,4 и 0,1% остатков находились в предпочтительной, разрешенной и выпадающей областях соответственно. Статистика сбора и уточнения данных представлена ​​в таблице 1.

    Таблица 1 Статистика сбора и уточнения данных.

    Конструирование

    клеток OPTN -KO

    Вектор gRNA_cloning (41824) и pCAG-hCas9 (51142) были получены от Addgene.Нуклеотидная последовательность 5′-CCcacgagaacagtctccactg-3 ‘в экзоне 5 гена OPTN человека была выбрана в качестве мишени для гРНК. Эти плазмиды и устойчивый к пуромицину вектор (pXS-Puro) котрансфицировали в клетки HeLa и BJAB. Через два дня после трансфекции клетки отбирали пуромицином в течение 2 дней, а затем колонии клеток получали путем ограничивающего разведения. Редактирование генома гена OPTN подвергали скринингу с помощью ПЦР и анализов расщепления Bss SI, и нуклеотидные мутации подтверждали секвенированием.

    Количественная ПЦР и ELISA

    Лизис клеток, обратная транскрипция и количественная ПЦР были выполнены с помощью SuperPrep Cell Lysis, RT Kit для количественной ПЦР и Power SYBR Green PCR Master Mix (Life Technologies), соответственно, в соответствии с инструкциями производителя. Количественная ПЦР в реальном времени была выполнена с помощью системы ПЦР Step-One-Plus (Applied Biosystems) методом ΔΔCT, используя следующие олигонуклеотиды: смысл IL-6, 5′-AGCCACTCACCTCTTCAGAAC-3 ‘и антисмысловой IL-6, 5’-GCCTCTTTGCTGCTTTCACAC-3 ‘; BIRC3 смысловой, 5’-AGATGAAAATGCAGAGTCATCAAT-3 ‘и антисмысловой BIRC3, 5′-CATGATTGCATCTTCTGAATGG-3′; Смысл ICAM1, 5’-GTGGTAGCAGCCGCAGT-3 ‘и антисмысловой ICAM1, 5′-TTCGGTTTCATGGGGGT-3′; NFKBIA смысловой, 5’-CGGGCTGAAGAAGGAGCGGC-3 ‘и антисмысловой NFKBIA, 5′-ACGAGTCCCCGTCCTCGGTG-3′; BCL-2a смысловой, 5’-CAGGAGAATGGATAAGGCAAA-3 ‘и BCL-2a антисмысловой, 5′-CCAGCCAGATTTAGGTTCAAA-3′; TNFAIP3 смысловой, 5’-CATGCATGCCACTTCTCAGT-3 ‘и TNFAIP3 антисмысловой, 5′-CATGGGTGTGTCTGTGGAG-3′; и смысл GAPDH, 5’-AGCAACAGGGTGGTGGAC-3 ‘и антисмысловой GAPDH, 5′-GTGTGGTGGGGGACTGAG-3’. Секретируемый человеческий IL-6 измеряли с помощью набора для ELISA (eBioscience).

    Анализ комплекса I TNFR1

    Образование комплекса TNFR при стимуляции TNF-α анализировали с использованием FLAG-меченного TNF-α 51 . Вкратце, клетки HeLa стимулировали в течение указанного времени с помощью 1 мкг мл -1 FLAG-меченного TNF-α, а затем лизировали в 1 мл лизисного буфера (50 мМ трис-HCl pH 7,5, 150 мМ NaCl, 1% тритон X- 100 и полный коктейль ингибиторов протеазы) в течение 15 мин на льду. Лизаты подвергали иммунопреципитации 15 мкл гранул анти-FLAG M2 (Sigma) в течение ночи при 4 ° C.Гранулы извлекали центрифугированием, восемь раз промывали 1 мл буфера для лизиса, а затем анализировали с помощью SDS-PAGE и иммуноблоттинга.

    Анализ выживаемости клеток

    Число жизнеспособных клеток измеряли с помощью набора для анализа нерадиоактивной пролиферации клеток CellTiter 96 AQueous (Promega) на основе MTS (3- (4,5-диметилтиазол-2-ил) -5 Колориметрический анализ на основе соединения — (3-карбоксиметоксифенил) -2- (4-сульфофенил) -2H-тетразолий) и анализ исключения трипанового синего. Более того, цитоплазматические гистон-ассоциированные фрагменты ДНК (моно- и олигонуклеосомы), образовавшиеся после индуцированной гибели клеток, измеряли с помощью ELISA для обнаружения гибели клеток (Roche) в соответствии с инструкциями производителя.zVAD-FMK (BD Biosciences) использовали в качестве ингибитора панкаспаз.

    Информация для пациента

    У пациента с пробандом гомозиготного рецессивного OPTN-Q398X развились дизартрия, мышечная слабость и усиление глубокого сухожильного рефлекса в возрасте 52 лет 24,37 . С другой стороны, пациент с пробандом гетерозиготного доминантного OPTN-E478G показал мышечную слабость, дизартрию, усиление глубокого сухожильного рефлекса и атрофию языка в возрасте 56 лет 24,38 .

    Иммуногистохимия

    Для невропатологических исследований закрепленные формалином залитые парафином срезы толщиной 6 мкм депарафинизировали, автоклавировали и инкубировали в течение ночи с данным первичным антителом, таким как антилинейный убиквитин (клон LUB9, MABS451, Millipore; 1: 100; 1: 100 ), анти-фосфо-p65 (pSer536) (600-401-265, Rockland; 1: 200), анти-расщепленная каспаза 3 (9661, Cell Signaling; 1: 100) и анти-расщепленная каспаза 8 (9496, Cell Signaling). ; 1:50). Связанные антитела выявляли с помощью набора Vectastain Elite ABC (Vector Laboratories) с 3,3’-диаминобензидинтетрагидрохлоридом в качестве хромогена 38 .Для двойного иммунофлуоресцентного окрашивания кроличьи поликлональные антитела против фосфо-TDP-43 (pSer409) (TIP-PTD-P03, Cosmo Bio; 1: 2,000) и мышиные моноклональные антитела против фосфо-TDP-43 (pSer 409/410) (TIP-PTD-M01, Cosmo Bio; 1: 2,000) обрабатывали антителами против линейного убиквитина и P-p65 соответственно. Первичные антитела были обнаружены с помощью Alexa Fluor 488- (ослиные антимышиные, A21202; ослиные антимышиные, A21200; молекулярные зонды; 1: 200) или вторичных антител, конъюгированных с Alexa Fluor 546 (ослиные антимышиные, A10036; ослиные анти-мышиные антитела, -rabbit, A10040; 1: 200) и наблюдали с помощью конфокального лазерного сканирующего микроскопа FLUOVIEW FV-1000 (Olympus) 38 .Процедуры, связанные с использованием человеческих материалов, были выполнены в соответствии с этическими принципами, установленными Медицинским университетом Вакаямы и Хельсинкской декларацией. Для количественного исследования этих активированных каспаз-положительных клеток мы получили от четырех до шести отдельных срезов из каждого случая для каждого антитела, и два исследователя, у которых не было информации о клиническом состоянии человека, предоставившего образец спинного мозга, провели наблюдения. Подсчитывали только клетки переднего рога с отчетливым ядром и ядрышком.

    Статистический анализ

    Односторонний дисперсионный анализ с последующим тестом post-hoc Тьюки с использованием программного обеспечения KaleidaGraph. Для всех тестов значение P <0,05 считалось статистически значимым.

    Доступность данных

    Координаты и структурные факторы области OPTN CC2-UBAN в комплексе с линейным тетраубиквитином были депонированы в банке данных белков под кодами доступа 5B83.Авторы заявляют, что данные, подтверждающие выводы этого исследования, доступны в статье и файлах с дополнительной информацией или могут быть предоставлены соответствующими авторами по запросу.

    ScienceCentral

    Аннотация

    На основе исследования локуса количественных признаков (QTL) с использованием скрещивания F 2 между ландрасом и коренными корейскими свиньями был идентифицирован значительный QTL, влияющий на количество сосков в SSC7. Ген сильного позиционного кандидата, TBC1D21 , был выбран из-за его биологической функции для развития эпителиальных мезенхимальных клеток.Анализ последовательности выявил шесть однонуклеотидных полиморфизмов (SNP) в гене TBC1D21 . Среди них два маркера SNP, одна молчащая мутация (SNP01) для g.13,050A> G и одна миссенс-мутация (SNP04) для c.829A> T (S277C), были генотипированы, и они показали значительную связь с признаками количества сосков (p значение = 6,38E-05 для SNP01 и значение p = 1,06E-07 для SNP04 с общим количеством сосков). Дальнейшая функциональная проверка этих SNP может дать ценную информацию для понимания изменения количества сосков у свиней.

    Ключевые слова: QTL, SNP, SSC7, TBC1D21 , номер соски, свинья

    ВВЕДЕНИЕ

    Количество сосков у свиней является важным признаком, поскольку они определяют материнские способности свиноматок. Количество доступных сосков также может влиять на количество живорожденных в помете и вес поросят при отъеме, и эти характеристики связаны с условиями матери для следующего потомства. Обычно большинство репродуктивных признаков имеют очень низкую наследуемость. Однако номера сосков имеют относительно среднюю наследуемость ( h 2 = 0.32) по сравнению с другими репродуктивными признаками, что указывает на то, что индивидуальный отбор может применяться для генетического улучшения этого признака (Pumfrey et al., 1980). Это также предполагает, что идентификация причинных мутаций в количестве сосков будет более осуществима, чем по другим репродуктивным признакам, таким как маленький размер. Ранее было проведено сканирование генома для определения причинных хромосомных положений по количеству сосков в геноме свиньи, и было выявлено несколько локусов количественных признаков (QTL). Wada et al. (2000) идентифицировали значимые QTL в SSC1 и SSC7 из кросс-популяции Meishan × Göttingen. Информация о QTL была обобщена в базе данных под названием «Animal QTLdb», и база данных идентифицировала 78 областей QTL в 13 аутосомах (SSC1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 15, 17). и Х-хромосома. В частности, QTL, связанные с числом сосков, 10 и 9 были идентифицированы на SSC1 и SSC7 соответственно (http://www.animalgenome.org/cgi-bin/QTLdb/SS/index). Недавно позиционный ген-кандидат на SSC5, PTHLH (гормон, подобный паратироидному гормону), был исследован на предмет взаимосвязи с количеством сосков.Однако результаты показали, что не было значимой связи с генотипом PTHLH и фенотипом числа сосков (Martinez-Giner et al., 2011).

    В нашем исследовании QTL с использованием скрещивания F 2 между ландрасом и коренными корейскими свиньями, два значимых QTL были идентифицированы в SSC1 и SSC7 (данные не показаны). Когда мы сравнивали эти два QTL, QTL SSC7 был более значимым, чем QTL на SSC1, и дальнейшие исследования проводились только для SSC7 QTL. В значимой области QTL TBC1D21 был выбран в качестве гена-кандидата на основании возможной функции этого гена.

    Таким образом, цель данного исследования состояла в том, чтобы изучить взаимосвязь между SNP в гене позиционного кандидата, TBC1D21 , и признаками числа сосков в межкроссной популяции F 2 между ландрасами и коренными корейскими свиньями.

    МАТЕРИАЛЫ И МЕТОДЫ

    Животные

    В последнее время наблюдается относительное увеличение использования местных корейских свиней не только для мясных целей, но и для животных моделей (Oh et al., 2011). Животные, использованные в этом исследовании, были из трех поколений ресурсной популяции, полученной путем скрещивания свиней ландраса и местных корейских свиней (Cho et al., 2011). Вкратце, девятнадцать чистокровных KNP (восемь самцов и одиннадцать женщин) были скрещены с семнадцатью чистокровными ландрасами (восемь самцов и девять самок). От этих скрещиваний было получено 91 потомство F1 и 1106 потомков F2 (568 самцов и 538 самок) от 79 полных сибсовых семей. Количество сосков (общее количество сосков, количество правых сосков и количество левых сосков) было подсчитано у 1105 потомков F 2 (568 самцов и 537 самок) от 79 полноплодных семей в этой ресурсной популяции Из них только F 2 животное успешно генотипированные были включены в дальнейший ассоциативный анализ в это исследование.

    Анализ секвенирования

    Первоначально 18 животных F 0 в ресурсной популяции использовали для обнаружения однонуклеотидных полиморфизмов (SNP). После очистки продуктов ПЦР с использованием набора для очистки ПЦР (Bioneer, Корея) продукты секвенировали в Cosmo Genetech (http://www.cosmogentech.com). Последовательности ДНК анализировали с помощью программы BioEdit ver. 7.0.0 (Ibis Therapeutics, США) и SNP были идентифицированы путем ручного поиска результатов электрофореграммы (данные не показаны).

    Генотипирование

    Для анализа пиросеквенирования двух SNP в гене TBC1D21 для реакций ПЦР использовали наборы праймеров и праймеры минисеквенирования (таблица 1). Реакции проводили с использованием 50 нг геномной ДНК, 0,4 мкМ каждого праймера, 1,5 мМ MgCl 2 , реакционного буфера (Genetbio, Корея), 0,2 мМ dNTP и ДНК-полимеразы Taq (Genetbio, Корея) в реакционном объеме 25 мкл. . Условия ПЦР составляли 35 циклов по 30 секунд при 94 ° C (денатурация), 45 секунд при 64 ° C (отжиг), 45 секунд при 72 ° C (элонгация) и 2 минуты при 94 ° C (денатурация).Генотип продуктов ПЦР анализировали с помощью пиросеквенатора (PyroMark, США).

    Статистический анализ

    Тест Стьюдента был проведен для проверки разницы между количеством левых и правых сосков с использованием пакета SAS версии 9.2 (SAS, США). Связь между признаками количества сосков и маркерами SNP была проанализирована с помощью смешанной модели с использованием опции PROC MIXED, реализованной в пакете SAS версии 9. 2. Модель включала отца и мать (вложенных в одного производителя) как случайные эффекты, пол и генотип как фиксированные эффекты.Существенные различия между средними значениями наименьших квадратов для разных генотипов были вычислены с использованием контрастного теста. Если не указано иное, значение было установлено в pBarrett et al., 2005). LD между маркерами SNP оценивали путем расчета попарного измерения LD, описанного Левонтином (Lewontin, 1964).

    РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

    Среднее общее количество сосков у F 2 особи составило 13,67 ± 0,039 с минимальным и максимальным значениями 10 и 18 соответственно. Не было разницы в количестве сосков между правой и левой (p = 0.19, таблица 2). Когда мы сравнили среднее количество сосков с другим исследованием, аналогичные результаты наблюдались у породы ландрас, у которой среднее количество сосков составляло 13,78 ± 1,3. С другой стороны, чистокровные коренные корейские свиньи имели среднее значение 12,10 ± 1,2, что указывает на по крайней мере один соск меньше, чем у ландраса и нынешних свиней F 2 (Seo et al., 1996). В предыдущих исследованиях сообщалось, что аналогичные положения QTL на SSC7 имеют значимые положения пиков QTL между 49,4 и 100,9 сМ (Wada et al., 2000; Кэссиди и др., 2001; Биданель и др., 2008). Однако ни одно из предыдущих исследований не исследовало гены-кандидаты в этой области QTL. Используя текущее F 2 человека в этом исследовании, мы также идентифицировали QTL соски, расположенный в аналогичной хромосомной области SSC7, по сравнению с предыдущими исследованиями (данные не показаны). В этой области QTL TBC1D21 был выбран в качестве гена позиционного кандидата на основании возможной функции этого гена. TBC1D21 Ген (член 21 семейства доменов TBC1) расположен на хромосоме 15 человека, действует как белок, активирующий GTPase для белков семейства Rab.Белки семейства Rab включают G-белки суперсемейства Ras, которые принадлежат белковому суперсемейству малых GTPases. У человека идентифицировано около 70 типов Rab. Они являются регуляторами мембранного движения, включая образование пузырьков, движение пузырьков вдоль сетей актина и тубулина и слияние мембран (Fuchs et al., 2007). Следовательно, ген TBC1D21 , который содержит домен Rab-GAP (белок активации GTPase), может оказывать значительное влияние на передачу сигналов в эпителиальном мезенхимальном взаимодействии во время формирования молочной железы.Таким образом, ген TBC1D21 был исследован как важный позиционный ген-кандидат в этой области. Для идентификации SNP гена TBC1D21 было выполнено секвенирование. Путем ручного исследования результата секвенирования этого гена мы идентифицировали шесть SNP в экзонных областях. Среди шести вариантов последовательности для генотипирования были выбраны два SNP (SNP01 и SNP04). SNP01 (g.13,050A> G) был выявлен как молчащая мутация, а SNP04 (c.829A> T (S277C)) как миссенс-мутация. Результаты гапловизора показали, что эти два SNP сильно связаны, поэтому ожидалось, что значимые результаты будут очень похожи друг на друга (Рисунок 1).Для эффективного генотипирования идентифицированных двух SNP было проведено пиросеквенирование (рис. 2). В случае SNP01 идентифицированные частоты аллелей составляли 0,8 для аллеля A и 0,2 для аллеля G, а частоты генотипов составляли 0,7 (AA), 0,21 (AG) и 0,09 (GG) (таблица 3). Кроме того, для SNP04 выявленные частоты аллелей составляли 0,84 и 0,16 для аллелей A и T соответственно, а частота генотипов составляла 0,05, 0,22 и 0,73 для генотипов TT, TA и AA соответственно (Таблица 3).Модель смешанного эффекта была использована для исследования влияния SNP в гене TBC1D21 на количество сосков в скрещивании F 2 между свиньями KNP и Landrace. Два SNP, которые были генотипированы, были высоко значимыми, что указывает на большую значимость SNP04, чем SNP01 (таблица 4). Идентифицированное значение P для общего количества сосков составило 1,06E-07 и 6,38E-05 для SNP04 и SNP01, соответственно. Результаты показали, что большее предпочтение менее частым гомозиготным аллелям в обоих SNP.В предыдущем исследовании ген PTHLH был выбран в качестве позиционного гена-кандидата на SSC5 в области QTL, потому что этот ген вносит вклад в формирование соска (Martinez-Giner et al., 2011). В настоящее время ген TBC1D21 был выбран в качестве первого гена-кандидата на SSC7, и два идентифицированных генотипированных SNP были значимыми для признаков количества сосков. Дальнейшая функциональная проверка выявленных мутаций в этом гене может в значительной степени способствовать увеличению числа сосков у свиноматок, что также может быть использовано для повышения продуктивности свиней.

    БЛАГОДАРНОСТИ

    Это исследование было поддержано грантом Программы развития технологий (проект № 110061-03-1-CG000) для сельского и лесного хозяйства Министерства продовольствия, сельского хозяйства, лесного хозяйства и рыболовства Республики Корея.

    ССЫЛКИ

    Барретт Дж. К., Фрай Б., Маллер Дж., Дэйли М. Дж. 2005. Haploview: Анализ и визуализация карт LD и гаплотипов. Биоинформатика. 21: 263–265.
    [CrossRef] [PDF] [Google Scholar]
    Биданель Дж. П., Розендо А., Iannuccelli N., Riquet J., Gilbert H., Caritez JC., Billon Y., Amigues Y., Prunier A., ​​Milan D. 2008. Выявление локусов количественных признаков для количества сосков и репродуктивных признаков самок в Meishan × Large Белый F 2 свин. Животное. 2: 813–820.
    [CrossRef] [Google Scholar]
    Кэссиди Дж. П., Джонсон Р. К., Помп Д., Рорер Г. А., Ван Флек Л. Д., Шпигель Е. К., Гилсон К. М.. 2001. Идентификация локусов количественных признаков, влияющих на воспроизводство у свиней. J Anim Sci. 79: 623–633.
    [CrossRef] [Google Scholar]
    Чо IC., Park HB., Yoo CK., Lee GJ., Lim HT., Lee JB., Jung EJ., Ko MS., Lee JH., Jeon JT. 2011. Анализ QTL лейкоцитов, тромбоцитов и признаков, связанных с эритроцитами, при скрещивании F 2 между ландрасом и коренными корейскими свиньями. Anim Genet. 42: 621–626.
    [CrossRef] [Google Scholar]
    Fuchs E., Haas AK., Spooner RA., Yoshimura S.-i., Lord JM., Barr FA. 2007. Специфические белки, активирующие ГТФазу Rab, определяют пути захвата токсина шига и эпидермального фактора роста. J Cell Biol.177: 1133–1143.
    [CrossRef] [PDF] [Google Scholar]
    Левонтин RC. 1964. Взаимодействие выбора и связывания. I. Общие соображения; Гетеротические модели. Генетика. 49: 49–67.
    [CrossRef] [Google Scholar]
    Мартинес-Гинер М., Ногера Дж. Л., Балселлс И., Алвес Э., Варона Л., Пена Р. Н.. 2011. Исследование экспрессии гена свиньи PTHLH и его взаимосвязи с количеством сосков свиньи. J Anim Breed Genet. 128: 344–353.
    [CrossRef] [Google Scholar]
    О, HG., Jung WY., Yu SL., Lee JH. 2011. Анализ экспрессии эндогенных ретровирусов свиней (PERV) в органах коренных корейских свиней. CNU J Agric Sci. 38: 71–77.
    [Google Scholar]
    Памфри Р.А., Джонсон Р.К., Каннингем П.Дж., Циммерман Д.Р. 1980. Наследование количества сосков и его связь с материнскими признаками у свиней. J Anim Sci. 50: 1057–1060.
    [CrossRef] [PDF] [Google Scholar]
    Seo KS., Kim SH., Park YI. 1996. Оценка генетических параметров количества сосков у свиней. Корейский J Anim Sci.38: 133–138.
    [Google Scholar]
    Wada Y., Akita T., Awata T., Furukawa T., Sugai N., Ishii K., Ito Y., Kobayashi E., Mikawa S., Yasue H. 2008. Анализ локусов количественных признаков (QTL) в Поперечное население Мейшан × Геттинген. Anim Genet. 31: 376–384.
    [Google Scholar]

    Рисунок 1.

    экзонных нуклеотидных вариантов и LD-блок гена TBC1D21 . Для анализа гаплотипов блок неравновесия по сцеплению (LD) между маркерами SNP оценивали с помощью Haploview v4.2 программное обеспечение.

    Рисунок 2.

    Результаты пиросеквенирования и генотипы гена TBC1D21 . (A) Пиросеквенирование SNP01, экзонного нуклеотида g.13,050A> G (B) Пиросеквенирование SNP04, экзонного нуклеотида g. 11,496A> T (c.829A> T (S277C)).

    Таблица 1.

    Набор праймеров для пиросеквенирования для генотипирования SNP в гене TBC1D21

    Название праймера СНП (позиция) Последовательность (5 ‘→ 3’) Размер продукта ПЦР (п.н.)
    TBC1D21F1 (биотин) SNP01 TCTAGCCCTGGCATTCTCTC 420
    TBC1D21 R1 (грамм.13,050A> G) ATTCCTCGTTCCCTGCATC
    TBC1D21 M1 CAGGATCAGGTCCAATGGGG
    TBC1D21 F 2 (биотин) СНП04 TGTCACAGGAGGGACAAAGG 483
    TBC1D21 R2 (g. 11,496A> T TCCTAAGGGCATCTGCAGTC
    TBC1D21 M2 c.829A> T (S277C)) CCCAGGTGCTGGTGGCCTAC
    Таблица 2.

    Основные статистические данные по количеству сосков у свиней F 2 скрещивания свиней KNP и Landrace

    Фенотип Среднее Стандартное отклонение Минимум Максимум
    Общее количество сосков 1105 13,665 1,288 10 18
    Левая соска номер 1105 6. 812 0,734 5 9
    Правая соска номер 1105 6,853 0,741 5 9
    Таблица 3.

    Частоты аллелей и генотипов для SNP в гене TBC1D21

    SNP Частота аллелей Частота генотипа


    SNP01 0.2 (Г) 0,8 (А) 0,09 (ГГ) 0,21 (GA) 0,7 (AA)
    g.13,050A> G
    СНП04 0,16 (Т) 0,84 (А) 0,05 (TT) 0,22 (TA) 0,73 (AA)
    g.11,496A> T
    (c. 829A> Т (S277C))
    Таблица 4.

    Влияние SNP в гене TBC1D21 на количество сосков у F 2 скрещивание свиней KNP и Landrace

    SNP Черта Генотип
    p значение
    GG (SE) AG (SE) AA (SE)
    SNP01 Общее количество сосков 12.94 (0,17) а 13,44 (0,10) b 13,73 (0,07) с 6.38E-05
    g.13,050A> G Левая соска номер 6,58 (0,10) 6,75 (0,06) 6,83 (0,04) 0,08
    Правая соска номер 6,36 (0,10) a 6,69 (0,06) b 6,90 (0,04) с 2.36E-06

    TT (SE) TA (SE) AA (SE)

    СНП04 Общее количество сосков 12,60 (0,17) а 13,27 (0,09) б 13,58 (0,06) с 1. 06E-07
    g.11,496A> T Левая соска номер 6,23 (0,10) a 6,62 (0,05) б 6,80 (0,03) с 3.92E-07
    [c.829A> T (S277C)] Правая соска номер 6,38 (0,10) a 6,64 (0,06) б 6,78 (0,03) с 0,00029

    1.0 еженедельно0.1 еженедельно0.1 еженедельно0.1 еженедельно0.1 еженедельно0.1 еженедельно0.1 еженедельно0.1 еженедельно0.1 еженедельно0.1 еженедельно0.1 еженедельно0.1 еженедельно0.1 еженедельно0.1 еженедельно0.1 еженедельно0.1 еженедельно0.1 еженедельно0.92018-01-29 + 0312: 10: 10: 10: 10: 00 еженедельно0.92018-01-29 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-03-15T13: 23: 03 + 03: 00 еженедельно 0.92018-03-15T13: 25: 34 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-03-15T13: 24: 33 + 03: 00 еженедельно 0. 92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-03-15T13: 26: 12 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018- 01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018- 01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00недельно0. 92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00недель0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0. 92018-01-29T12: 10: 11 + 03: 00недель0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0. 92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00недельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00недель0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0. 92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0. 92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00недельно0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00weekly0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно 0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92018-01-29T12: 10: 11 + 03: 00 еженедельно0.92017-03-06T17: 50: 27 + 03: 00 еженедельно 0.92017-03-15T20: 49: 51 + 03: 00 еженедельно 0.92017-03-15T20: 58: 01 + 03: 00 еженедельно 0.92018-03-20T21: 12: 12 + 03: 00 еженедельно 0.92018-03-20T21: 10: 45 + 03: 00 еженедельно 0.92018-01-23T20: 27: 24 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-03-16T17: 02: 16 + 03: 00 еженедельно 0.92017-03-28T12: 49: 02 + 03: 00 еженедельно 0.92017-03-15T20: 58: 31 + 03: 00 еженедельно 0.92017-10-24T18: 52: 08 + 03: 00 еженедельно 0.92017-09-02T17: 04: 35 + 03: 00 еженедельно 0.92018-03-02T15: 29: 14 + 03: 00 еженедельно 0.92017-09-20T22: 45: 17 + 03: 00 еженедельно 0.92017-09-20T22: 45: 59 + 03: 00 еженедельно 0.92017-09-20T22: 43: 57 + 03: 00 еженедельно 0.92018-02-28T20: 21: 42 + 03: 00 еженедельно 0. 92017-03-03T17: 53: 54 + 03: 00 еженедельно 0.92017-03-03T17: 53: 54 + 03: 00 еженедельно 0.92017-03-03T17: 53: 54 + 03: 00 еженедельно 0.92017-03-03T17: 53: 54 + 03: 00 еженедельно 0.92018-02-28T20: 22: 08 + 03: 00 еженедельно 0.92016-08-08T20: 05: 25 + 03: 00 еженедельно 0.92017-03-03T17: 53: 54 + 03: 00 еженедельно0.92017-03-03T17: 53: 54 + 03: 00 еженедельно 0.92017-12-05T13: 43: 35 + 03: 00 еженедельно 0.92017-03-03T17: 53: 54 + 03: 00 еженедельно 0.92017-03-03T17: 53: 54 + 03: 00 еженедельно 0.92017-03-03T17: 53: 54 + 03: 00 еженедельно0.92017-12-05T13: 29: 44 + 03: 00 еженедельно 0.92017-03-03T17: 53: 55 + 03: 00 еженедельно 0.92017-03-03T17: 53: 55 + 03: 00 еженедельно 0.92017-03-03T17: 53: 55 + 03: 00недельно0.92017-03-03T17: 53: 55 + 03: 00недельно0.92017-03-03T17: 53: 55 + 03: 00недельно0.92017-03-03T17: 53: 55 + 03: 00 еженедельно0.92017-03-03T17: 53: 55 + 03: 00 еженедельно0.92017-03-03T17: 53: 55 + 03: 00 еженедельно 0.92018-02-09T11: 30: 36 + 03: 00 еженедельно 0.92017-03-03T17: 53: 55 + 03: 00 еженедельно0.92017-03-03T17: 53: 55 + 03: 00 еженедельно 0.92017-03-03T17: 53: 55 + 03: 00 еженедельно0.92017-03-03T17: 53: 55 + 03: 00 еженедельно 0.92017-12-05T13: 11: 28 + 03: 00 еженедельно 0.92017-12-05T13: 18: 49 + 03: 00 еженедельно 0.92017-03-03T17: 53: 56 + 03: 00 еженедельно 0.92017-03-03T17: 53: 56 + 03: 00 еженедельно 0.92017-03-03T17: 53: 56 + 03: 00недельно0.92017-03-03T17: 53: 56 + 03: 00 еженедельно 0.92017-12-05T13: 41: 08 + 03: 00 еженедельно 0.92017-12-05T13: 40: 56 + 03: 00 еженедельно 0.92018-01-23T13: 09: 24 + 03: 00 еженедельно 0.92018-01-23T13: 10: 31 + 03: 00 еженедельно 0.92018-01-23T13: 10: 53 + 03: 00 еженедельно 0.92018-01-23T13: 12: 12 + 03: 00 еженедельно 0. 92018-01-23T13: 26: 43 + 03: 00 еженедельно 0.92018-01-23T13: 26: 43 + 03: 00 еженедельно 0.92018-01-23T13: 26: 43 + 03: 00 еженедельно 0.92018-01-23T13: 26: 43 + 03: 00 еженедельно 0.92018-01-23T13: 11: 37 + 03: 00 еженедельно 0.92018-01-23T13: 09: 54 + 03: 00 еженедельно 0.92018-06-06T16: 28: 21 + 03: 00 еженедельно 0.92018-05-15T16: 56: 08 + 03: 00 еженедельно 0.92018-01-23T13: 19: 14 + 03: 00 еженедельно 0.92018-06-06T16: 28: 50 + 03: 00 еженедельно 0.92018-01-23T13: 18: 57 + 03: 00 еженедельно 0.92018-01-23T13: 19: 26 + 03: 00 еженедельно 0.92018-06-06T16: 19: 59 + 03: 00 еженедельно 0.92018-06-06T16: 29: 53 + 03: 00 еженедельно0.92017-12-05T13: 28: 15 + 03: 00 еженедельно 0.92018-01-13T09: 09: 36 + 03: 00 еженедельно 0.92018-01-13T09: 04: 55 + 03: 00 еженедельно 0.92018-01-13T09: 05: 22 + 03: 00 еженедельно 0.92018-01-13T09: 05: 37 + 03: 00 еженедельно 0.92018-01-13T09: 06: 16 + 03: 00 еженедельно 0.92018-01-13T09: 06: 01 + 03: 00 еженедельно 0.92018-01-13T09: 06: 28 + 03: 00 еженедельно 0.92018-01-13T09: 06: 53 + 03: 00 еженедельно 0.92018-01-13T09: 06: 41 + 03: 00 еженедельно 0.92018-01-13T09: 07: 04 + 03: 00 еженедельно 0.92018-01-13T09: 07: 29 + 03: 00 еженедельно 0.92018-01-13T09: 07: 16 + 03: 00 еженедельно0.92018-01-13T09: 07: 40 + 03: 00 еженедельно 0.92018-01-13T09: 07: 54 + 03: 00 еженедельно 0.92018-01-13T09: 08: 06 + 03: 00 еженедельно 0.92018-01-13T09: 08: 29 + 03: 00 еженедельно0.92018-01-13T09: 08: 17 + 03: 00 еженедельно 0.92018-01-13T09: 08: 42 + 03: 00 еженедельно 0.92018-01-13T09: 08: 53 + 03: 00 еженедельно0.92018-01-13T09: 09: 06 + 03: 00 еженедельно 0.92018-01-13T09: 09: 17 + 03: 00 еженедельно 0. 92018-04-04T17: 15: 15 + 03: 00 еженедельно 0.92018-01-31T15: 17: 30 + 03: 00 еженедельно 0.92018-01-31T15: 19: 00 + 03: 00 еженедельно 0.92018-01-31T15: 18: 28 + 03: 00 еженедельно 0.92018-01-31T15: 18: 43 + 03: 00 еженедельно 0.92018-01-31T15: 18: 04 + 03: 00 еженедельно 0.92018-01-13T09: 03: 00 + 03: 00 еженедельно 0.92018-01-13T09: 03: 10 + 03: 00 еженедельно 0.92018-01-13T09: 03: 22 + 03: 00 еженедельно 0.92018-01-13T09: 03: 31 + 03: 00 еженедельно 0.92018-01-13T09: 03: 41 + 03: 00 еженедельно 0.92018-01-13T09: 03: 51 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 24 + 03: 00 еженедельно 0.92018-01-23T20: 27: 24 + 03: 00 еженедельно 0.92018-01-23T20: 27: 24 + 03: 00 еженедельно 0.92018-01-23T20: 27: 24 + 03: 00 еженедельно 0.92018-01-23T20: 27: 24 + 03: 00 еженедельно 0.92018-01-23T20: 27: 24 + 03: 00 еженедельно 0.92018-01-23T20: 27: 24 + 03: 00 еженедельно 0.92018-01-23T20: 27: 24 + 03: 00 еженедельно 0.92018-01-23T20: 27: 24 + 03: 00 еженедельно 0.92018-01-23T20: 27: 24 + 03: 00 еженедельно 0.92018-01-23T20: 27: 24 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0. 92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-01-23T20: 27: 53 + 03: 00 еженедельно 0.92018-06-08T12: 27: 58 + 03: 00 еженедельно 0.92018-06-01T10: 50: 32 + 03: 00 еженедельно 0.92018-06-08T12: 42: 52 + 03: 00 еженедельно 0.92018-06-08T12: 44: 50 + 03: 00 еженедельно 0.92018-05-30T15: 58: 22 + 03: 00 еженедельно 0.92018-06-06T10: 45: 27 + 03: 00 еженедельно 0.92018-05-30T16: 18: 03 + 03: 00 еженедельно 0.92018-05-30T16: 50: 05 + 03: 00 еженедельно 0.92018-05-30T16: 25: 15 + 03: 00 еженедельно 0.92018-05-31T12: 46: 00 + 03: 00 еженедельно 0.92018-02-19T11: 46: 23 + 03: 00 еженедельно 0.92018-05-30T16: 43: 46 + 03: 00 еженедельно 0.92018-05-30T15: 40: 17 + 03: 00 еженедельно 0.92018-05-30T14: 39: 27 + 03: 00 еженедельно 0.92018-05-31T12: 50: 24 + 03: 00 еженедельно 0.92018-05-31T12: 51: 28 + 03: 00 еженедельно 0.92018-06-01T14: 47: 41 + 03: 00 еженедельно 0.92018-06-01T15: 31: 39 + 03: 00 еженедельно 0.92018-05-31T11: 33: 53 + 03: 00 еженедельно 0.92018-05-30T17: 20: 37 + 03: 00 еженедельно 0.92018-03-15T19: 46: 06 + 03: 00 еженедельно 0.92018-06-01T14: 57: 31 + 03: 00 еженедельно 0.92018-05-31T11: 07: 04 + 03: 00 еженедельно 0.92018-05-28T12: 05: 35 + 03: 00 еженедельно 0.92018-05-30T13: 43: 49 + 03: 00 еженедельно 0.92018-06-01T15: 28: 58 + 03: 00 еженедельно 0.92018-05-31T13: 06: 43 + 03: 00 еженедельно 0.92017-04-06T12: 11: 24 + 03: 00 еженедельно 0.92018-02-21T16: 14: 11 + 03: 00 еженедельно 0.92018-02-08T15: 50: 39 + 03: 00 еженедельно 0.92018-04-05T16: 17: 10 + 03: 00 еженедельно 0.92018-01-31T15: 27: 49 + 03: 00 еженедельно 0.92018-04-04T16: 10: 12 + 03: 00 еженедельно 0.92018-06-08T12: 43: 11 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92017-09-02T17: 00: 18 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92017-09-02T18: 56: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-01-23T20: 49: 05 + 03: 00 еженедельно 0.92018-06-08T12: 32: 01 + 03: 00 еженедельно 0.92018-05-31T16: 13: 14 + 03: 00 еженедельно 0.92018-05-10T09: 36: 46 + 03: 00 еженедельно 0.92018-01-23T20: 49: 38 + 03: 00 еженедельно 0.92018-01-23T20: 49: 38 + 03: 00 еженедельно 0.92018-05-30T16: 33: 42 + 03: 00 еженедельно 0.92018-06-08T12: 43: 03 + 03: 00 еженедельно 0.92018-05-30T14: 24: 42 + 03: 00 еженедельно 0.92018-05-30T14: 27: 36 + 03: 00 еженедельно 0.92018-05-18T12: 26: 29 + 03: 00 еженедельно 0.92018-03-30T15: 38: 41 + 03: 00 еженедельно 0.92018-03-30T15: 38: 43 + 03: 00 еженедельно 0.92018-05-04T11: 12: 02 + 03: 00 еженедельно 0.92018-05-29T15: 41: 30 + 03: 00 еженедельно 0.92018-03-19T12: 19: 31 + 03: 00 еженедельно 0.92018-05-29T15: 39: 28 + 03: 00 еженедельно 0.92018-03-19T14: 52: 46 + 03: 00 еженедельно 0.92018-04-05T17: 46: 00 + 03: 00 еженедельно 0.92018-03-19T14: 53: 57 + 03: 00 еженедельно 0.92018-05-29T16: 00: 17 + 03: 00 еженедельно 0.92018-03-19T14: 53: 57 + 03: 00 еженедельно 0.92018-05-30T12: 39: 48 + 03: 00 еженедельно 0.92018-05-17T17: 01: 26 + 03: 00 еженедельно 0.92018-03-19T14: 53: 57 + 03: 00 еженедельно 0.92018-03-19T14: 53: 57 + 03: 00 еженедельно 0.92018-05-29T15: 40: 06 + 03: 00 еженедельно 0.92018-03-19T15: 32: 31 + 03: 00 еженедельно 0.92018-05-25T16: 50: 13 + 03: 00 еженедельно 0.92018-05-25T16: 51: 21 + 03: 00 еженедельно 0.92018-05-25T16: 51: 57 + 03: 00 еженедельно 0.92018-05-09T06: 58: 54 + 03: 00 еженедельно 0.92018-05-09T06: 59: 44 + 03: 00 еженедельно 0.92018-05-25T16: 50: 59 + 03: 00 еженедельно 0.92018-05-25T16: 51: 45 + 03: 00 еженедельно 0.92018-05-25T16: 51: 33 + 03: 00 еженедельно 0.92018-05-04T16: 11: 20 + 03: 00 еженедельно 0.92018-05-04T16: 12: 03 + 03: 00 еженедельно 0.92018-04-25T18: 13: 13 + 03: 00 еженедельно 0.92018-05-25T16: 49: 58 + 03: 00 еженедельно 0.92018-06-07T13: 14: 49 + 03: 00 еженедельно 0.92018-05-25T16: 50: 28 + 03: 00 еженедельно 0.92018-06-06T10: 46: 39 + 03: 00 еженедельно 0.92018-06-06T10: 46: 54 + 03: 00 еженедельно 0.92018-05-17T16: 38: 17 + 03: 00 еженедельно 0.92018-05-25T16: 44: 17 + 03: 00 еженедельно 0.92018-06-08T11: 02: 42 + 03: 00 еженедельно 0.82018-03-22T23: 32: 33 + 03: 00 еженедельно0.82018-03-22T23: 33: 35 + 03: 00 еженедельно0.82018-03-22T23: 29: 39 + 03: 00 еженедельно 0.82016-05-28T00: 48: 04 + 03: 00 еженедельно0.82016-05-28T00: 48: 04 + 03: 00 еженедельно0.82016-05-28T00: 48: 04 + 03: 00 еженедельно0.82016-05-28T00: 48: 04 + 03: 00недельно0.82016-05-28T00: 48: 04 + 03: 00недельно0.82016-05-28T00: 48: 04 + 03: 00недельно0.82016-05-28T00: 48: 04 + 03: 00 еженедельно0.82016-05-28T00: 48: 04 + 03: 00 еженедельно0.82016-05-28T00: 48: 04 + 03: 00 еженедельно0.82016-05-28T00: 48: 04 + 03: 00недельно0.82016-05-28T00: 48: 04 + 03: 00недельно0.82016-05-28T00: 48: 04 + 03: 00недельно0.82016-05-28T00: 48: 04 + 03: 00недельно0.82016- 05-28T00: 48: 04 + 03: 00недельно0.82016-05-28T00: 48: 04 + 03: 00недельно0.82016-05-28T00: 48: 04 + 03: 00недельно0.82016-05-28T00: 48: 04+ 03: 00 еженедельно0.82016-05-28T00: 48: 04 + 03: 00 еженедельно0.82016-05-28T00: 48: 04 + 03: 00 еженедельно0.82016-05-28T00: 48: 04 + 03: 00 еженедельно0.82016-05- 28T00: 48: 04 + 03: 00 еженедельно0.82016-05-28T00: 48: 04 + 03: 00 еженедельно0.82016-05-28T00: 48: 04 + 03: 00 еженедельно0.82016-05-28T00: 48: 04 + 03: 00 еженедельно0.82016-05-28T00: 48: 04 + 03: 00недельно0.82016-05-28T00: 48: 04 + 03: 00недельно0.82016-05-28T00: 48: 04 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016- 08-04T15: 57: 01 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05+ 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05- 28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016- 05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05+ 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05- 28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016- 05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05+ 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05- 28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016- 05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05+ 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05- 28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016- 05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05+ 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05- 28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016- 05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05+ 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05- 28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00 еженедельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016-05-28T00: 48: 05 + 03: 00недельно0.82016- 05-28T00: 48: 05 + 03: 00 еженедельно0.82018-03-22T23: 33: 32 + 03: 00 еженедельно0.82018-01-22T18: 32: 55 + 03: 00 еженедельно 0.82018-03-22T23: 33: 29 + 03: 00 еженедельно0.82018-03-22T23: 33: 35 + 03: 00 еженедельно0.82017-03-15T19: 25: 40 + 03: 00недельно0.82016-10-20T18: 42: 15 + 03: 00недельно0.82017-07-05T11: 32: 20 + 03: 00недельно0.82017-03-15T18: 05: 27 + 03: 00недельно0.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *